SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g19095

Feature Type:gene_model
Chromosome:Gm12
Start:19737812
stop:19738403
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma12g19095
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G55220AT Annotation by Michelle Graham. TAIR10: trigger factor type chaperone family protein | chr5:22397677-22400678 FORWARD LENGTH=547 SoyBaseE_val: 2.00E-36ISS
GO:0000023GO-bp Annotation by Michelle Graham. GO Biological Process: maltose metabolic process SoyBaseN/AISS
GO:0006457GO-bp Annotation by Michelle Graham. GO Biological Process: protein folding SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0015031GO-bp Annotation by Michelle Graham. GO Biological Process: protein transport SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0016556GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA modification SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0003755GO-mf Annotation by Michelle Graham. GO Molecular Function: peptidyl-prolyl cis-trans isomerase activity SoyBaseN/AISS
PF05698PFAM Bacterial trigger factor protein (TF) C-terminus JGI ISS
UniRef100_G7K8P7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Trigger factor n=2 Tax=Medicago truncatula RepID=G7K8P7_MEDTR SoyBaseE_val: 3.00E-40ISS
UniRef100_I1M6M4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M6M4_SOYBN SoyBaseE_val: 4.00E-49ISS

Expression Patterns of Glyma12g19095
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g19095 not represented in the dataset
Glyma12g19095 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma12g19095 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g159900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma12g19095
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma12g19095
>Glyma12g19095.1   sequence type=CDS   gene model=Glyma12g19095   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTCTATTGCTGATAAGCTTCTCCTTGGATGCACCACAGCGGAGCAGAGTAAAAGACTTGTCGTTACAGAAATGCCAAGAGGTGGAGCAAACAGCTAGAGAACAAGTCACTGATAATGCTATCTTAGATCAGATTTCTAAGACTGTACAAGTTGATATACCTCAATCCTTGTTTGAGGAACAAGGAAGGCAACTTTATGGAGCCAACCTATTAGAAATACAGGCAAAAATGAAGTTAAATCAGCAGCAGCTAGTGACTCTGTCAACTTCAAAGGCTGTGAACGAATTTCTTGAGCATCAAAAAGAAAATATAACAAATTTGATAAAAACAGAGTGTGCCAGTTGGTGA
Predicted protein sequences of Glyma12g19095
>Glyma12g19095.1   sequence type=predicted peptide   gene model=Glyma12g19095   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MILLLISFSLDAPQRSRVKDLSLQKCQEVEQTAREQVTDNAILDQISKTVQVDIPQSLFEEQGRQLYGANLLEIQAKMKLNQQQLVTLSTSKAVNEFLEHQKENITNLIKTECASW*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo