SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma12g15430

Feature Type:gene_model
Chromosome:Gm12
Start:14262412
stop:14264634
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G42690AT Annotation by Michelle Graham. TAIR10: alpha/beta-Hydrolases superfamily protein | chr2:17776356-17777682 REVERSE LENGTH=412 SoyBaseE_val: 2.00E-102ISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0009650GO-bp Annotation by Michelle Graham. GO Biological Process: UV protection SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019375GO-bp Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0071493GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to UV-B SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0004806GO-mf Annotation by Michelle Graham. GO Molecular Function: triglyceride lipase activity SoyBaseN/AISS
GO:0008970GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphatidylcholine 1-acylhydrolase activity SoyBaseN/AISS
PF01764PFAM Lipase (class 3) JGI ISS
UniRef100_G7JCM9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Feruloyl esterase A n=1 Tax=Medicago truncatula RepID=G7JCM9_MEDTR SoyBaseE_val: 2.00E-124ISS
UniRef100_I1LSH3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LSH3_SOYBN SoyBaseE_val: 2.00E-165ISS

LocusGene SymbolProtein Name
PLA1-IId Phospholipase A1-Iid

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g129200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma12g15430.2   sequence type=CDS   gene model=Glyma12g15430   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGGGTTGGCTCACAATCTACACGTCTGACAACCCAAAATCCCCCTTTACCAAATCCAGCGCAAGAACGCAGCTTCAAGCCCACGTCAAATCCCTCTTACAACATTACAGCTCTGAGAACCCCAGCTTGGTCATCGTGGGGCACAGCCTCGGCGCAACCCTATCCATCGTGAGCGCCTTCGACCTGGTCGAAAACGGGGTAACGGAGGTCCCGGTCACCGCCATCGTGTTCGGGTCCCCCCAGGTCGGAAACAAGGCCTTCAACGAGAGGTTCAACATGTTTCCGAACTTGAAAGTTTTGCACGTGAAGAACGTGATCGATTTGATCCCACACTACCCGGGGAAGTTGTTAGGGTATGAGTACATGGGCACGGAGCTGGTGATAGACACGAGGAAGTCGCCGAGCTTGAAGGACTCGAGGAACCCGGGTGATTGGCATAACTTGCAAGCGATGTTGCATGTGGTGGCGGGGTGGAATGGGAAGAAGGAGGAGTTTGAGATGAGGGTGAAGAGGAGTGTGGCGTTGGTGAATAAGTCGTGTGAGTTTCTGAAGGAGGAATATGGCGTGCCAGGGTCGTGGTGGGTGGAGAAGAATAAGGGGATGGTGAAGAGGGAGGATGGGGAGTGGGTGTTGGATGCGCCAGATGAGGAGGATGTGCCTGTGCTCGAAGAGATTTGA

>Glyma12g15430.2   sequence type=predicted peptide   gene model=Glyma12g15430   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSGWLTIYTSDNPKSPFTKSSARTQLQAHVKSLLQHYSSENPSLVIVGHSLGATLSIVSAFDLVENGVTEVPVTAIVFGSPQVGNKAFNERFNMFPNLKVLHVKNVIDLIPHYPGKLLGYEYMGTELVIDTRKSPSLKDSRNPGDWHNLQAMLHVVAGWNGKKEEFEMRVKRSVALVNKSCEFLKEEYGVPGSWWVEKNKGMVKREDGEWVLDAPDEEDVPVLEEI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo