Glyma12g14007 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g14007

Feature Type:	gene_model
Chromosome:	Gm12
Start:	12700268
stop:	12703417
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g14007

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G28510	AT	Annotation by Michelle Graham. TAIR10: Optic atrophy 3 protein (OPA3) \| chr1:10024036-10025939 FORWARD LENGTH=171	SoyBase	E_val: 5.00E-69	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
KOG3335	KOG	Predicted coiled-coil protein	JGI		ISS
PTHR12499	Panther	OPTIC ATROPHY 3 PROTEIN (OPA3)	JGI		ISS
PF07047	PFAM	Optic atrophy 3 protein (OPA3)	JGI		ISS
UniRef100_B9SGN9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Optic atrophy 3 protein, putative n=1 Tax=Ricinus communis RepID=B9SGN9_RICCO	SoyBase	E_val: 2.00E-82	ISS
UniRef100_I1KEV8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KEV8_SOYBN	SoyBase	E_val: 1.00E-108	ISS

Expression Patterns of Glyma12g14007

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g14007 not represented in the dataset	Glyma12g14007 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g14007

Paralog	Evidence	Comments
Glyma06g43900	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g14007 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.12g119900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma12g14007

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g14007

Limit To All Plant Sequences

>Glyma12g14007.1   sequence type=CDS   gene model=Glyma12g14007   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGGTGCTTCCGGTGGTGAAGCTAGCAACACTCGCTCTGAGAACCGCGTGCAAACCAATCGCCAACAGGCTCAAGAAGGAGGCCGGTTACCACCCCAAGTTCCGAAATTTCATCATCAGCATTGCCCAGGCCAATCATAGATTGACGACGAGAGTGCAGAGACGAATTTACAGTCATGCCACTGATGTTGCAATCCGCCCTTTGAACGAGGAGAAGGCTGTGCAAGCTGCTGCTGATCTGCTTGGAGAACTCTTTGTTTTCTCGGTTGCAGGAGCTGCCATCATCTTTGAGGTGCAAAGAAGTTCAAGATCAGAAGCAAGAAAAGAAGAACTACGTACACAGGAGATTGAGGAAATAAAGACTAAGAATGAAGAATTGGCTAGAGAAATTGCACTTCTTGCACAAAAGCTTGAAGAGCTGGAACAACTTTCCAGGGGACGAGGACTACTTGGCACTCTTAATATCAAACACAGTCGTGTCTCTCAAGATAGAAAATCTAATTGA

Predicted protein sequences of Glyma12g14007

Limit To All Plant Sequences

>Glyma12g14007.1   sequence type=predicted peptide   gene model=Glyma12g14007   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVVLPVVKLATLALRTACKPIANRLKKEAGYHPKFRNFIISIAQANHRLTTRVQRRIYSHATDVAIRPLNEEKAVQAAADLLGELFVFSVAGAAIIFEVQRSSRSEARKEELRTQEIEEIKTKNEELAREIALLAQKLEELEQLSRGRGLLGTLNIKHSRVSQDRKSN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain