SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G28480 | AT | Annotation by Michelle Graham. TAIR10: Thioredoxin superfamily protein | chr1:10013634-10014047 REVERSE LENGTH=137 | SoyBase | E_val: 9.00E-43 | ISS |
| GO:0000165 | GO-bp | Annotation by Michelle Graham. GO Biological Process: MAPK cascade | SoyBase | N/A | ISS |
| GO:0006355 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0006612 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane | SoyBase | N/A | ISS |
| GO:0007154 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell communication | SoyBase | N/A | ISS |
| GO:0007165 | GO-bp | Annotation by Michelle Graham. GO Biological Process: signal transduction | SoyBase | N/A | ISS |
| GO:0009409 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cold | SoyBase | N/A | ISS |
| GO:0009410 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to xenobiotic stimulus | SoyBase | N/A | ISS |
| GO:0009414 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to water deprivation | SoyBase | N/A | ISS |
| GO:0009611 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to wounding | SoyBase | N/A | ISS |
| GO:0009617 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to bacterium | SoyBase | N/A | ISS |
| GO:0009693 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ethylene biosynthetic process | SoyBase | N/A | ISS |
| GO:0009695 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009723 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus | SoyBase | N/A | ISS |
| GO:0009733 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus | SoyBase | N/A | ISS |
| GO:0009738 | GO-bp | Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009751 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus | SoyBase | N/A | ISS |
| GO:0009753 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus | SoyBase | N/A | ISS |
| GO:0009814 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction | SoyBase | N/A | ISS |
| GO:0009862 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009863 | GO-bp | Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009867 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0010310 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process | SoyBase | N/A | ISS |
| GO:0010363 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response | SoyBase | N/A | ISS |
| GO:0030968 | GO-bp | Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response | SoyBase | N/A | ISS |
| GO:0031348 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response | SoyBase | N/A | ISS |
| GO:0035304 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation | SoyBase | N/A | ISS |
| GO:0042538 | GO-bp | Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response | SoyBase | N/A | ISS |
| GO:0042742 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to bacterium | SoyBase | N/A | ISS |
| GO:0043069 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death | SoyBase | N/A | ISS |
| GO:0045454 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell redox homeostasis | SoyBase | N/A | ISS |
| GO:0050832 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to fungus | SoyBase | N/A | ISS |
| GO:0051707 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to other organism | SoyBase | N/A | ISS |
| GO:0005737 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0009055 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: electron carrier activity | SoyBase | N/A | ISS |
| GO:0015035 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein disulfide oxidoreductase activity | SoyBase | N/A | ISS |
| KOG1752 | KOG | Glutaredoxin and related proteins | JGI | ISS | |
| PTHR10168 | Panther | GLUTAREDOXIN | JGI | ISS | |
| PTHR10168:SF47 | Panther | GLUTAREDOXIN | JGI | ISS | |
| PF00462 | PFAM | Glutaredoxin | JGI | ISS | |
| UniRef100_C6T0K0 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T0K0_SOYBN | SoyBase | E_val: 2.00E-123 | ISS |
| UniRef100_G7JUX5 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Glutaredoxin-C9 n=1 Tax=Medicago truncatula RepID=G7JUX5_MEDTR | SoyBase | E_val: 4.00E-61 | ISS |
|
Glyma12g13920 not represented in the dataset |
Glyma12g13920 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma06g44050 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.12g119200 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma12g13920.1 sequence type=CDS gene model=Glyma12g13920 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGCAACAAGCAATTCCTTATAGGTCATGGCAACCTCTCATCACACCCACCAACGCCAACACCACTCACTTCACAATTAGCCCACACACATTAGTAACCTTTTCCACAGTGTCTACAACAGAATTATCTCTAAAAGACGATATTGGTTCGGAACCGAATAACAACATCCATAATAGTGATAATCCTTTCTTTGTTTCCTCCAAAATGGTGCCCAACATGGTCTTAGAGAGCGCGATTATAGTCTTCGCTAGGCGTGGTTGTTGCATGAGCCATGTTGTGAAGCGATTGCTGCTGGGTCTTGGGGTGAACCCTGCGGTGCACGAGGTGGAGGAGAGTGATGAAGTGGGTGTTGTTAGAGAATTGGAAGCAATTGTGGGTGCCAATAATGGAGGGAATAAGATGCAATTTCCAGCAGTTTTTATTGGTGGCAAATTGTTTGGGGGATTGGATAAGGTAATGGCTACTCATATTTCAGGGGAATTGGTTCCAATTCTCAAAGAAGCAGGAGCTCTATGGCTTTGA
>Glyma12g13920.1 sequence type=predicted peptide gene model=Glyma12g13920 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MQQAIPYRSWQPLITPTNANTTHFTISPHTLVTFSTVSTTELSLKDDIGSEPNNNIHNSDNPFFVSSKMVPNMVLESAIIVFARRGCCMSHVVKRLLLGLGVNPAVHEVEESDEVGVVRELEAIVGANNGGNKMQFPAVFIGGKLFGGLDKVMATHISGELVPILKEAGALWL*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
