Report for Sequence Feature Glyma12g13090
Feature Type: gene_model
Chromosome: Gm12
Start: 11449237
stop: 11449791
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma12g13090
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G10250 AT
Annotation by Michelle Graham. TAIR10: HSP20-like chaperones superfamily protein | chr4:6370537-6371124 FORWARD LENGTH=195
SoyBase E_val: 2.00E-57 ISS
GO:0006457 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein folding
SoyBase N/A ISS
GO:0009408 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to heat
SoyBase N/A ISS
GO:0009644 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to high light intensity
SoyBase N/A ISS
GO:0042542 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide
SoyBase N/A ISS
GO:0005783 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PTHR11527 Panther
SMALL HEAT-SHOCK PROTEIN (HSP20) FAMILY
JGI ISS
PTHR11527:SF14 Panther
LETHAL(2) ESSENTIAL FOR LIFE - RELATED
JGI ISS
PF00011 PFAM
Hsp20/alpha crystallin family
JGI ISS
UniRef100_Q39820 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Hsp22.5 n=1 Tax=Glycine max RepID=Q39820_SOYBN
SoyBase E_val: 1.00E-79 ISS
UniRef100_UPI000233B48E UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233B48E related cluster n=1 Tax=unknown RepID=UPI000233B48E
SoyBase E_val: 1.00E-102 ISS
Expression Patterns of Glyma12g13090
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Gene model name correspondences to Glyma12g13090 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.12g115300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma12g13090
Coding sequences of Glyma12g13090
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma12g13090.1 sequence type=CDS gene model=Glyma12g13090 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAGGCACTTTTTAGTACTAGTACCACTGATCTTGCTTGTTTTTGCTGGTTTTCCATCCAAAGCAAAAGGCTCTCTGCTACCATTCACAAATCATCCAAATACCCTCTTGGCTGATCTATGGTCTAATCATTTCCCTGATCCATTTCGCGTGTTAGAGCAAATCCCATTTGGGGTTGACAAAGATGAAACATTCACAGCTCTATCATCACATGCAAGAGTGGATTGGAAGGAGACACCAGAAGGGCATGTCATAATGCTAGATGTGCCAGGGTTGAAGAGAGATGAGATCAAGATAGAAGTGGAAGGGAATAGAGTGCTGAGAGTGAGTGGAGAAAGGAAGAGGGAAGAGGAGAAGGAAGGGGATCATTGGCATAGAGTGGAGAGATCCTATGGCAAATTCTGGAGGCATTTCAAGGTGCCAGACAATGTGGACTCTCAAGGTCAATTATAA
Predicted protein sequences of Glyma12g13090
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma12g13090.1 sequence type=predicted peptide gene model=Glyma12g13090 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MRHFLVLVPLILLVFAGFPSKAKGSLLPFTNHPNTLLADLWSNHFPDPFRVLEQIPFGVDKDETFTALSSHARVDWKETPEGHVIMLDVPGLKRDEIKIEVEGNRVLRVSGERKREEEKEGDHWHRVERSYGKFWRHFKVPDNVDSQGQL*