SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g10260): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g10260): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g10260

Feature Type:gene_model
Chromosome:Gm12
Start:8120323
stop:8121462
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma12g10260
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G11690AT Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06380.1); Has 84 Blast hits to 84 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:3695484-3696242 FORWARD LENGTH=252 SoyBaseE_val: 1.00E-16ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_Q43713UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pollen preferential protein n=1 Tax=Lilium longiflorum RepID=Q43713_LILLO SoyBaseE_val: 1.00E-13ISS
UniRef100_UPI000233C755UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233C755 related cluster n=1 Tax=unknown RepID=UPI000233C755 SoyBaseE_val: 8.00E-107ISS

Expression Patterns of Glyma12g10260
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g10260 not represented in the dataset
Glyma12g10260 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g10260
ParalogEvidenceComments
Glyma06g46500 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g10260 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g096500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma12g10260
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma12g10260
>Glyma12g10260.2   sequence type=CDS   gene model=Glyma12g10260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCACCAAGTCATGGTCCGTCCGCAGCCGGCCCACGGCCACCGGAGACGCGGCGTCGGCGAGGTGGCCGGCGGCGTCGCGGCCGACTGCGCAGCCGTGTGCTGCTGCTGTCCTTGCACGGTCGTCAACCTCGTCGTCCTCGCGGTGTACAAACTCCCCAAGAGACTCGTGAAGAAGGCTGCGAATAAGAGACGGCGCCGTTTGCCGAAGAAGAACAGCACCGACGTCGTGCTGTTGCAGCCGCAGAGATCGAGCAGCGTGGACGCGCTCGACTTCGCGGTGGGGCCCATGTTCTTTGAAGAGTTTCTCAAGAATGAAAAAGAGTCCGAGAACGAGAAGGGCAAGGAGGAAGAGGAAGAGGAAGAGGAAGAGGAAGAAGAAGAAGGATTGGAGATGGAGATGTGGGCCCGGTTCGCGGGAACCGGGTTCTGGCGGAGCGAGTCTCAGCGTCAACCCTAA
Predicted protein sequences of Glyma12g10260
>Glyma12g10260.2   sequence type=predicted peptide   gene model=Glyma12g10260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAHQVMVRPQPAHGHRRRGVGEVAGGVAADCAAVCCCCPCTVVNLVVLAVYKLPKRLVKKAANKRRRRLPKKNSTDVVLLQPQRSSSVDALDFAVGPMFFEEFLKNEKESENEKGKEEEEEEEEEEEEEGLEMEMWARFAGTGFWRSESQRQP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo