Report for Sequence Feature Glyma12g08660
Feature Type: gene_model
Chromosome: Gm12
Start: 6415668
stop: 6417608
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma12g08660
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G28200 AT
Annotation by Michelle Graham. TAIR10: C2H2-type zinc finger family protein | chr2:12024321-12025181 FORWARD LENGTH=286
SoyBase E_val: 3.00E-56 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0010228 GO-bp
Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem
SoyBase N/A ISS
GO:0016926 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein desumoylation
SoyBase N/A ISS
GO:0048573 GO-bp
Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering
SoyBase N/A ISS
GO:0050665 GO-bp
Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide biosynthetic process
SoyBase N/A ISS
GO:0005622 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: intracellular
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003676 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
GO:0008270 GO-mf
Annotation by Michelle Graham. GO Molecular Function: zinc ion binding
SoyBase N/A ISS
PTHR26374 Panther
FAMILY NOT NAMED
JGI ISS
PTHR26374:SF459 Panther
JGI ISS
UniRef100_G7JN94 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: ZPT2-11 n=1 Tax=Medicago truncatula RepID=G7JN94_MEDTR
SoyBase E_val: 1.00E-80 ISS
UniRef100_I1LR94 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LR94_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma12g08660
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma12g08660
Paralog Evidence Comments
Glyma11g19830 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma12g08660 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.12g081400 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma12g08660
Coding sequences of Glyma12g08660
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma12g08660.1 sequence type=CDS gene model=Glyma12g08660 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGAAGGGTTGGATTCTAATAATTCTACCCACAACAGCATAGCCAAGGGCAAACGCACTAAGAGGATGAGGCTTTTGTCCCCTTGCGGTGTCATCGTTGCTGCCATCACCACCACCACCACCGTCACCTCGAGCACTTCGAGTGCTAATTCGGGTGCCTCGTCCACCACAACCTACGAGAGCGAAGAGGAGGACATGGCGAATTGTTTGATTCTCTTGGCCCAAGGAGGGGAATCTCGTCATCATCCTCGTCACGACAAGCAACAAGTTGAAGATCATGGTCTTGAGAATTGTGATGATGGTGCCATCAAGACAGAAGAAAAGGGTAACAGCAGCAACGTTAACACTACCACCGCCGCAACAACAACTGCTGCTAATAATAATACCAAAGTTGGTTTCTATATTTATGAGTGCAAAACGTGTAACCGAACCTTCCCTTCGTTTCAAGCACTGGGTGGACATAGGGCGAGTCACAAGAAGCCCAAACTCGCGGCTGAAGAGAAAAAACAACCACTGCCACCGTCACCGCTACCACCGCCAACACCGTCTCAATTGCAACACATGATTGTTACCAATTATGATCGGTTTGAGGAGGGTAGCGTTAAAAGTGGTCCTCCAATTTCCCTTCAATTGGGTAATAATGGAAACAACAACAAGGGTAAGATTCACGAGTGTTCCATTTGTGGCTCTGAATTCACATCAGGACAAGCATTGGGTGGACACATGAGGAGGCATAGGGCATCCACAAACGCCAACAATGTTGTTGACACAACAAGTTGTAACACTGTCATCACCACCACCATTACCGCGGTTCCACCGAGGAATATTTTGCAATTGGATCTTAACCTCCCGGCACCGGAGGATGATCTCCGAGAGGCTAAATTCCAATTTACAGCAACAAGTCAGGTGCTGGTTGGTACTCCGGCTTTGGTGGATTGTCATTATTAA
Predicted protein sequences of Glyma12g08660
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma12g08660.1 sequence type=predicted peptide gene model=Glyma12g08660 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MEGLDSNNSTHNSIAKGKRTKRMRLLSPCGVIVAAITTTTTVTSSTSSANSGASSTTTYESEEEDMANCLILLAQGGESRHHPRHDKQQVEDHGLENCDDGAIKTEEKGNSSNVNTTTAATTTAANNNTKVGFYIYECKTCNRTFPSFQALGGHRASHKKPKLAAEEKKQPLPPSPLPPPTPSQLQHMIVTNYDRFEEGSVKSGPPISLQLGNNGNNNKGKIHECSICGSEFTSGQALGGHMRRHRASTNANNVVDTTSCNTVITTTITAVPPRNILQLDLNLPAPEDDLREAKFQFTATSQVLVGTPALVDCHY*