SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g08650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g08650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g08650

Feature Type:gene_model
Chromosome:Gm12
Start:6393909
stop:6398362
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G28190AT Annotation by Michelle Graham. TAIR10: copper/zinc superoxide dismutase 2 | chr2:12014548-12016303 FORWARD LENGTH=216 SoyBaseE_val: 1.00E-98ISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0010039GO-bp Annotation by Michelle Graham. GO Biological Process: response to iron ion SoyBaseN/AISS
GO:0019430GO-bp Annotation by Michelle Graham. GO Biological Process: removal of superoxide radicals SoyBaseN/AISS
GO:0034599GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to oxidative stress SoyBaseN/AISS
GO:0035195GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by miRNA SoyBaseN/AISS
GO:0046688GO-bp Annotation by Michelle Graham. GO Biological Process: response to copper ion SoyBaseN/AISS
GO:0071329GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to sucrose stimulus SoyBaseN/AISS
GO:0071457GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to ozone SoyBaseN/AISS
GO:0071472GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to salt stress SoyBaseN/AISS
GO:0071484GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to light intensity SoyBaseN/AISS
GO:0071493GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to UV-B SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0004784GO-mf Annotation by Michelle Graham. GO Molecular Function: superoxide dismutase activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0046872GO-mf Annotation by Michelle Graham. GO Molecular Function: metal ion binding SoyBaseN/AISS
KOG0441 KOG Cu2+/Zn2+ superoxide dismutase SOD1 JGI ISS
PTHR10003Panther CU/ZN SUPEROXIDE DISMUTASE JGI ISS
PF00080PFAM Copper/zinc superoxide dismutase (SODC) JGI ISS
UniRef100_I1LR93UniRef Annotation by Michelle Graham. Most informative UniRef hit: Superoxide dismutase [Cu-Zn] n=1 Tax=Glycine max RepID=I1LR93_SOYBN SoyBaseE_val: 3.00E-142ISS
UniRef100_I1LR93UniRef Annotation by Michelle Graham. Best UniRef hit: Superoxide dismutase [Cu-Zn] n=1 Tax=Glycine max RepID=I1LR93_SOYBN SoyBaseE_val: 3.00E-142ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g08650 not represented in the dataset

Glyma12g08650 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma11g19840 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g081300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma12g08650.1   sequence type=CDS   gene model=Glyma12g08650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAGCTAGCTGTGGCGGCCAACGCTGTCGTTTCACCGTCGCCGTTCCGACCTCATCCCCTTCTCCGGTCATCCTTCTCCGGCGTCTCCGTTAAGCTCACTCCCCAATCCATAACGTTTTCACGCTTGAAGCCCCTCACCGTCTTCGCCGCCACCAAGAAGGCCGTCGCTGTCCTCAAGGGGACCTCCGCCGTCGAAGGCGTCGCCACTCTCATCCAAGAAGACGATGGCCCGACGACAGTTTCTGTTAGCATCACTGGCCTTACTCCGGGGCTTCATGGTTTTCACCTACATGAGTATGGTGATACCACAAATGGGTGTATATCAACAGGAGCACATTTTAATCCTAATAACTTGACACATGGTGCTCCTGAGGATGAAGTCCGTCATGCGGGTGACCTGGGAAACATAGTTGCTAATGCAGAGGGGGTTGCAGAGGCTACAATTGTGGATAATCAGATACCACTCTCTGGCCCTAATTCAGTAGTTGGAAGAGCCTTGGTGGTCCATGAGCTTGAGGATGACCTTGGAAAGGGTGGGCATGAACTCAGTTTGACAACTGGAAATGCTGGTGGAAGATTAGCGTGTGGTGTGGTTGGTTTGACTCCAGCATAA

>Glyma12g08650.1   sequence type=predicted peptide   gene model=Glyma12g08650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQLAVAANAVVSPSPFRPHPLLRSSFSGVSVKLTPQSITFSRLKPLTVFAATKKAVAVLKGTSAVEGVATLIQEDDGPTTVSVSITGLTPGLHGFHLHEYGDTTNGCISTGAHFNPNNLTHGAPEDEVRHAGDLGNIVANAEGVAEATIVDNQIPLSGPNSVVGRALVVHELEDDLGKGGHELSLTTGNAGGRLACGVVGLTPA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo