Glyma12g08170 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g08170

Feature Type:	gene_model
Chromosome:	Gm12
Start:	5914480
stop:	5919778
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g08170

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G27490	AT	Annotation by Michelle Graham. TAIR10: 3'-5'-exoribonuclease family protein \| chr4:13739961-13741647 FORWARD LENGTH=256	SoyBase	E_val: 8.00E-137	ISS
GO:0006396	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA processing	SoyBase	N/A	ISS
GO:0009845	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed germination	SoyBase	N/A	ISS
GO:0009909	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of flower development	SoyBase	N/A	ISS
GO:0016570	GO-bp	Annotation by Michelle Graham. GO Biological Process: histone modification	SoyBase	N/A	ISS
GO:0034968	GO-bp	Annotation by Michelle Graham. GO Biological Process: histone lysine methylation	SoyBase	N/A	ISS
GO:0048449	GO-bp	Annotation by Michelle Graham. GO Biological Process: floral organ formation	SoyBase	N/A	ISS
GO:0090351	GO-bp	Annotation by Michelle Graham. GO Biological Process: seedling development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0000175	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 3'-5'-exoribonuclease activity	SoyBase	N/A	ISS
GO:0003723	GO-mf	Annotation by Michelle Graham. GO Molecular Function: RNA binding	SoyBase	N/A	ISS
GO:0008408	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 3'-5' exonuclease activity	SoyBase	N/A	ISS
KOG1068	KOG	Exosomal 3'-5' exoribonuclease complex, subunit Rrp41 and related exoribonucleases	JGI		ISS
PTHR11953	Panther	RIBONUCLEASE PH RELATED	JGI		ISS
PF01138	PFAM	3' exoribonuclease family, domain 1	JGI		ISS
PF03725	PFAM	3' exoribonuclease family, domain 2	JGI		ISS
UniRef100_G7JND2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Exosome complex exonuclease MTR3 n=1 Tax=Medicago truncatula RepID=G7JND2_MEDTR	SoyBase	E_val: 3.00E-166	ISS
UniRef100_I1LR48	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LR48_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma12g08170

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g08170

Paralog	Evidence	Comments
Glyma11g20420	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g08170 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.12g076900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma12g08170

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g08170

Limit To All Plant Sequences

>Glyma12g08170.1   sequence type=CDS   gene model=Glyma12g08170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGGCAAAGGTGGATCAACTCCGGCCACATATTCGCCGTCTCCGACGACCGATAAGAAGAAACCATCGCTTTTCAATGAGGATTTGGCTCGACCTGATGGCCGCAGTTTCCACCAGTGCAGACCCGCATTTTTCAGGACTGGTGCTGTGAATGCTGCATCTGGATCTGCTTATGCTGAGGTTGGAAATACCAAGGTCATTGTATCAGTATTTGGGCCAAGAGAGAGCAAGAAGGCGATGATGTACAGTGATATAGGGCGTTTGAATTGCAATGTCAGCTTTACAACGTTTGCAACTCCGATTCGTGGGCAGGGTTCAGACCACAAAGAGTACAGTTCAATGCTTCATAAAGCTTTGGAGGGAGCAATAATACTGGAAACATTCCCCAAGACAACTGTGGATGTCTTTGCATTGGTGCTGGAATCTAGTGGCAGTGATCTCCCAGTTGTCATATCATGTGCAAGCCTTGCCCTTGCAGATGCGGGAATAATGATGTATGATCTTGTTGCCTCAGTTTCTGTGTCATGTTTTAATAAGAACCTTGTCATTGATCCTGTTTTGGAGGAGGAAAATGGCCAAGATGGAAGCTTAATGATTACTTGCATGCCTTCTCGCTATGAAATCACCCAACTCACTGTTACTGGGGAATGGTCCACCCCAAAGATTAACGAGGGAATGCAGCTGTGTTTGGATGCTTGTGCAAAGCTTGCGAAGATTATGAGGTCATGTTTAAAAGAAGCTGTTTCGGATTCCCAGGAATAG

Predicted protein sequences of Glyma12g08170

Limit To All Plant Sequences

>Glyma12g08170.1   sequence type=predicted peptide   gene model=Glyma12g08170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGKGGSTPATYSPSPTTDKKKPSLFNEDLARPDGRSFHQCRPAFFRTGAVNAASGSAYAEVGNTKVIVSVFGPRESKKAMMYSDIGRLNCNVSFTTFATPIRGQGSDHKEYSSMLHKALEGAIILETFPKTTVDVFALVLESSGSDLPVVISCASLALADAGIMMYDLVASVSVSCFNKNLVIDPVLEEENGQDGSLMITCMPSRYEITQLTVTGEWSTPKINEGMQLCLDACAKLAKIMRSCLKEAVSDSQE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain