SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G07890 | AT | Annotation by Michelle Graham. TAIR10: ascorbate peroxidase 1 | chr1:2438005-2439435 FORWARD LENGTH=250 | SoyBase | E_val: 3.00E-151 | ISS |
| GO:0000302 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to reactive oxygen species | SoyBase | N/A | ISS |
| GO:0006094 | GO-bp | Annotation by Michelle Graham. GO Biological Process: gluconeogenesis | SoyBase | N/A | ISS |
| GO:0006096 | GO-bp | Annotation by Michelle Graham. GO Biological Process: glycolysis | SoyBase | N/A | ISS |
| GO:0006457 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein folding | SoyBase | N/A | ISS |
| GO:0006499 | GO-bp | Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation | SoyBase | N/A | ISS |
| GO:0006511 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process | SoyBase | N/A | ISS |
| GO:0006598 | GO-bp | Annotation by Michelle Graham. GO Biological Process: polyamine catabolic process | SoyBase | N/A | ISS |
| GO:0006833 | GO-bp | Annotation by Michelle Graham. GO Biological Process: water transport | SoyBase | N/A | ISS |
| GO:0006972 | GO-bp | Annotation by Michelle Graham. GO Biological Process: hyperosmotic response | SoyBase | N/A | ISS |
| GO:0006979 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to oxidative stress | SoyBase | N/A | ISS |
| GO:0007030 | GO-bp | Annotation by Michelle Graham. GO Biological Process: Golgi organization | SoyBase | N/A | ISS |
| GO:0009266 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus | SoyBase | N/A | ISS |
| GO:0009408 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to heat | SoyBase | N/A | ISS |
| GO:0009644 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to high light intensity | SoyBase | N/A | ISS |
| GO:0009651 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salt stress | SoyBase | N/A | ISS |
| GO:0009698 | GO-bp | Annotation by Michelle Graham. GO Biological Process: phenylpropanoid metabolic process | SoyBase | N/A | ISS |
| GO:0009793 | GO-bp | Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy | SoyBase | N/A | ISS |
| GO:0009853 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photorespiration | SoyBase | N/A | ISS |
| GO:0034976 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress | SoyBase | N/A | ISS |
| GO:0042398 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular modified amino acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0042542 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide | SoyBase | N/A | ISS |
| GO:0042744 | GO-bp | Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process | SoyBase | N/A | ISS |
| GO:0046686 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cadmium ion | SoyBase | N/A | ISS |
| GO:0051788 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to misfolded protein | SoyBase | N/A | ISS |
| GO:0055114 | GO-bp | Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process | SoyBase | N/A | ISS |
| GO:0080129 | GO-bp | Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly | SoyBase | N/A | ISS |
| GO:0005618 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cell wall | SoyBase | N/A | ISS |
| GO:0005737 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm | SoyBase | N/A | ISS |
| GO:0005794 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus | SoyBase | N/A | ISS |
| GO:0005829 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosol | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0009506 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0009570 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma | SoyBase | N/A | ISS |
| GO:0004601 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: peroxidase activity | SoyBase | N/A | ISS |
| GO:0016688 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: L-ascorbate peroxidase activity | SoyBase | N/A | ISS |
| GO:0020037 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: heme binding | SoyBase | N/A | ISS |
| PF00141 | PFAM | Peroxidase | JGI | ISS | |
| UniRef100_Q76LA6 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Cytosolic ascorbate peroxidase 2 n=1 Tax=Glycine max RepID=Q76LA6_SOYBN | SoyBase | E_val: 1.00E-180 | ISS |
| UniRef100_Q76LA6 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Cytosolic ascorbate peroxidase 2 n=1 Tax=Glycine max RepID=Q76LA6_SOYBN | SoyBase | E_val: 1.00E-180 | ISS |
|
Glyma12g07780 not represented in the dataset |
Glyma12g07780 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma11g15680 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.12g073100 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma12g07780.3 sequence type=CDS gene model=Glyma12g07780 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGGAAAGTCTTACCCAACCGTGAGCGCTGATTACCAGAAGGCCGTTGAGAAGGCGAAGAAGAAGCTCAGAGGCTTCATCGCTGAGAAGAGATGCGCTCCTCTAATGCTCCGTTTGGCATGGCACTCTGCTGGAACTTACGACGTGAGCTCGAAGACCGGTGGTCCCTTCGGAACCATAAAGCACCCCTCCGAACTCGCTCACGGCGCTAACAACGGTCTTGACATCGCTGTTAGGCTTTTGGAGCCACTCAAAGCGGAGTTTCCTATTTTGAGCTACGCCGATTTCTACCAGTTGGCTGGCGTTGTTGCCGTTGAGGTCACCGGTGGACCTGAAGTTCCCTTCCATCCTGGAAGAGAGGACAAACCTGAGCCACCACCAGAGGGTCGCTTGCCCGATGCCACTAAGGGTTCTGACCATTTGAGAGATGTGTTTGGCAAAGCTATGGGGCTTAGTGACCGAGATATCGTTGCTCTGTCTGGGGGTCACACTATTGGAGCTGCGCACAAGGAGCGTTCTGGATTCGAGGGTCCCTGGACCTCTAATCCTCTTATTTTCGACAACTCATACTTCAAGGAGTTGTTGAGTGGTGAGAAAGAAGGCCTCCTTCAGCTACCTTCTGACAAGGCACTTTTGTCTGACCCTGTGTTCCGCCCTCTTGTTGAGAAATATGCATCGGACGAAGATGCCTTCTTCGCTGATTACGCTGAGGCTCACCAAAAGCTTTCTGAGCTTGGGTTTGCTGAAGCCTAA
>Glyma12g07780.3 sequence type=predicted peptide gene model=Glyma12g07780 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MGKSYPTVSADYQKAVEKAKKKLRGFIAEKRCAPLMLRLAWHSAGTYDVSSKTGGPFGTIKHPSELAHGANNGLDIAVRLLEPLKAEFPILSYADFYQLAGVVAVEVTGGPEVPFHPGREDKPEPPPEGRLPDATKGSDHLRDVFGKAMGLSDRDIVALSGGHTIGAAHKERSGFEGPWTSNPLIFDNSYFKELLSGEKEGLLQLPSDKALLSDPVFRPLVEKYASDEDAFFADYAEAHQKLSELGFAEA*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
