SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G45640 | AT | Annotation by Michelle Graham. TAIR10: mitogen-activated protein kinase 3 | chr3:16756918-16758476 FORWARD LENGTH=370 | SoyBase | E_val: 0 | ISS |
| GO:0000165 | GO-bp | Annotation by Michelle Graham. GO Biological Process: MAPK cascade | SoyBase | N/A | ISS |
| GO:0000169 | GO-bp | Annotation by Michelle Graham. GO Biological Process: activation of MAPK activity involved in osmosensory signaling pathway | SoyBase | N/A | ISS |
| GO:0001666 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to hypoxia | SoyBase | N/A | ISS |
| GO:0006355 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0006468 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein phosphorylation | SoyBase | N/A | ISS |
| GO:0006612 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane | SoyBase | N/A | ISS |
| GO:0006970 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to osmotic stress | SoyBase | N/A | ISS |
| GO:0006979 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to oxidative stress | SoyBase | N/A | ISS |
| GO:0007165 | GO-bp | Annotation by Michelle Graham. GO Biological Process: signal transduction | SoyBase | N/A | ISS |
| GO:0009409 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cold | SoyBase | N/A | ISS |
| GO:0009595 | GO-bp | Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus | SoyBase | N/A | ISS |
| GO:0009611 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to wounding | SoyBase | N/A | ISS |
| GO:0009617 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to bacterium | SoyBase | N/A | ISS |
| GO:0009697 | GO-bp | Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009738 | GO-bp | Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009814 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction | SoyBase | N/A | ISS |
| GO:0009862 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009863 | GO-bp | Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009867 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0010120 | GO-bp | Annotation by Michelle Graham. GO Biological Process: camalexin biosynthetic process | SoyBase | N/A | ISS |
| GO:0010200 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to chitin | SoyBase | N/A | ISS |
| GO:0010224 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to UV-B | SoyBase | N/A | ISS |
| GO:0010310 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process | SoyBase | N/A | ISS |
| GO:0010363 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response | SoyBase | N/A | ISS |
| GO:0010374 | GO-bp | Annotation by Michelle Graham. GO Biological Process: stomatal complex development | SoyBase | N/A | ISS |
| GO:0019684 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction | SoyBase | N/A | ISS |
| GO:0031347 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of defense response | SoyBase | N/A | ISS |
| GO:0031348 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response | SoyBase | N/A | ISS |
| GO:0035304 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation | SoyBase | N/A | ISS |
| GO:0035556 | GO-bp | Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction | SoyBase | N/A | ISS |
| GO:0042742 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to bacterium | SoyBase | N/A | ISS |
| GO:0043069 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death | SoyBase | N/A | ISS |
| GO:0043900 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process | SoyBase | N/A | ISS |
| GO:0048481 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ovule development | SoyBase | N/A | ISS |
| GO:0050832 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to fungus | SoyBase | N/A | ISS |
| GO:0051707 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to other organism | SoyBase | N/A | ISS |
| GO:0080136 | GO-bp | Annotation by Michelle Graham. GO Biological Process: priming of cellular response to stress | SoyBase | N/A | ISS |
| GO:2000037 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of stomatal complex patterning | SoyBase | N/A | ISS |
| GO:2000038 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of stomatal complex development | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0004672 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein kinase activity | SoyBase | N/A | ISS |
| GO:0004707 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: MAP kinase activity | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0016301 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: kinase activity | SoyBase | N/A | ISS |
| KOG0660 | KOG | Mitogen-activated protein kinase | JGI | ISS | |
| PTHR24055 | Panther | MITOGEN-ACTIVATED PROTEIN KINASE | JGI | ISS | |
| PTHR24055:SF69 | Panther | JGI | ISS | ||
| PF00069 | PFAM | Protein kinase domain | JGI | ISS | |
| UniRef100_I1LR10 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LR10_SOYBN | SoyBase | E_val: 0 | ISS |
| UniRef100_Q5K6Q4 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Mitogen-activated protein kinase 1 n=1 Tax=Glycine max RepID=Q5K6Q4_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma12g07770 not represented in the dataset |
Glyma12g07770 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma11g15700 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.12g073000 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma12g07770.1 sequence type=CDS gene model=Glyma12g07770 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGCCGGAGTTAATCCAAACGGCGTCGCCGATTTTGCGGCGGTTCCGACGCATGGCGGACAGTTCATTCAGTACAACATATTTGGAAACCTCTTCGAGGTTACGACGAAGTACCGTCCTCCGATCATGCCTATCGGACGCGGCGCGTACGGAATCGTTTGCTCACTGTTGAATACCGAGACGAACGAGCTGGTGGCTGTGAAGAAGATAGCGAACGCTTTCGACAATCACATGGACGCTAAGCGTACGCTTCGTGAGATTAAGCTTCTTAGGCATTTGGATCATGAAAATGTAATTGGTTTGAGAGATGTTATTCCTCCACCCTTGCGTAGAGAGTTTAATGATGTCTACATAGCCACTGAACTCATGGATACTGATCTTCACCATATCATTCGCTCCAATCAAAATCTGTCAGAGGAGCACTGCCAATACTTCTTGTACCAGATTCTTCGTGGGCTTAAGTATATACATTCTGCAAACGTAATCCATAGAGATTTAAAACCAAGCAACCTGCTGCTAAACTCAAACTGTGATTTAAAGATTATTGATTTTGGTCTTGCGAGACCGACTTTGGAAAGTGACTTCATGACAGAATATGTAGTCACAAGATGGTATAGAGCTCCCGAATTGTTGTTGAACTCCTCTGATTACACCTCTGCTATAGATGTGTGGTCTGTTGGTTGCATCTTTATGGAGCTTATGAATAAAAAGCCTCTGTTTCCGGGCAAAGACCATGTGCATCAGATGCGCCTATTGACAGAGCTTCTTGGCACCCCAACTGAGGCTGACCTTGGGTTAGTGAAAAATGAAGATGCAAGAAGATATATCAGACAACTTCCTCAATATCCTCGCCAACCTTTAGCTCAAGTCTTCCCCCATGTTCATCCCGCAGCCATTGATCTTGTTGATAAAATGCTGACAGTTGATCCCACCAAAAGAATTACAGTTGAAGAAGCACTAGCCCATCCATACCTTGAAAAACTGCATGATGTAGCTGATGAACCAATCTGCATGGAGCCATTCTCATTTGATTTTGAGCAACAGCAATTGGATGAAGAGCAAATAAAAGAGATGATCTACAGGGAAGCATTAGCACTGAATCCTGAGTATGCTTAA
>Glyma12g07770.1 sequence type=predicted peptide gene model=Glyma12g07770 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MAGVNPNGVADFAAVPTHGGQFIQYNIFGNLFEVTTKYRPPIMPIGRGAYGIVCSLLNTETNELVAVKKIANAFDNHMDAKRTLREIKLLRHLDHENVIGLRDVIPPPLRREFNDVYIATELMDTDLHHIIRSNQNLSEEHCQYFLYQILRGLKYIHSANVIHRDLKPSNLLLNSNCDLKIIDFGLARPTLESDFMTEYVVTRWYRAPELLLNSSDYTSAIDVWSVGCIFMELMNKKPLFPGKDHVHQMRLLTELLGTPTEADLGLVKNEDARRYIRQLPQYPRQPLAQVFPHVHPAAIDLVDKMLTVDPTKRITVEEALAHPYLEKLHDVADEPICMEPFSFDFEQQQLDEEQIKEMIYREALALNPEYA*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
