SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g07770

Feature Type:gene_model
Chromosome:Gm12
Start:5380020
stop:5383515
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma12g07770
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G45640AT Annotation by Michelle Graham. TAIR10: mitogen-activated protein kinase 3 | chr3:16756918-16758476 FORWARD LENGTH=370 SoyBaseE_val: 0ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0000169GO-bp Annotation by Michelle Graham. GO Biological Process: activation of MAPK activity involved in osmosensory signaling pathway SoyBaseN/AISS
GO:0001666GO-bp Annotation by Michelle Graham. GO Biological Process: response to hypoxia SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010120GO-bp Annotation by Michelle Graham. GO Biological Process: camalexin biosynthetic process SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010224GO-bp Annotation by Michelle Graham. GO Biological Process: response to UV-B SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0010374GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex development SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0031347GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of defense response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0080136GO-bp Annotation by Michelle Graham. GO Biological Process: priming of cellular response to stress SoyBaseN/AISS
GO:2000037GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of stomatal complex patterning SoyBaseN/AISS
GO:2000038GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of stomatal complex development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004707GO-mf Annotation by Michelle Graham. GO Molecular Function: MAP kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
KOG0660 KOG Mitogen-activated protein kinase JGI ISS
PTHR24055Panther MITOGEN-ACTIVATED PROTEIN KINASE JGI ISS
PTHR24055:SF69Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_I1LR10UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LR10_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q5K6Q4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Mitogen-activated protein kinase 1 n=1 Tax=Glycine max RepID=Q5K6Q4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma12g07770
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g07770
ParalogEvidenceComments
Glyma11g15700 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g07770 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g073000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma12g07770
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma12g07770
>Glyma12g07770.1   sequence type=CDS   gene model=Glyma12g07770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCGGAGTTAATCCAAACGGCGTCGCCGATTTTGCGGCGGTTCCGACGCATGGCGGACAGTTCATTCAGTACAACATATTTGGAAACCTCTTCGAGGTTACGACGAAGTACCGTCCTCCGATCATGCCTATCGGACGCGGCGCGTACGGAATCGTTTGCTCACTGTTGAATACCGAGACGAACGAGCTGGTGGCTGTGAAGAAGATAGCGAACGCTTTCGACAATCACATGGACGCTAAGCGTACGCTTCGTGAGATTAAGCTTCTTAGGCATTTGGATCATGAAAATGTAATTGGTTTGAGAGATGTTATTCCTCCACCCTTGCGTAGAGAGTTTAATGATGTCTACATAGCCACTGAACTCATGGATACTGATCTTCACCATATCATTCGCTCCAATCAAAATCTGTCAGAGGAGCACTGCCAATACTTCTTGTACCAGATTCTTCGTGGGCTTAAGTATATACATTCTGCAAACGTAATCCATAGAGATTTAAAACCAAGCAACCTGCTGCTAAACTCAAACTGTGATTTAAAGATTATTGATTTTGGTCTTGCGAGACCGACTTTGGAAAGTGACTTCATGACAGAATATGTAGTCACAAGATGGTATAGAGCTCCCGAATTGTTGTTGAACTCCTCTGATTACACCTCTGCTATAGATGTGTGGTCTGTTGGTTGCATCTTTATGGAGCTTATGAATAAAAAGCCTCTGTTTCCGGGCAAAGACCATGTGCATCAGATGCGCCTATTGACAGAGCTTCTTGGCACCCCAACTGAGGCTGACCTTGGGTTAGTGAAAAATGAAGATGCAAGAAGATATATCAGACAACTTCCTCAATATCCTCGCCAACCTTTAGCTCAAGTCTTCCCCCATGTTCATCCCGCAGCCATTGATCTTGTTGATAAAATGCTGACAGTTGATCCCACCAAAAGAATTACAGTTGAAGAAGCACTAGCCCATCCATACCTTGAAAAACTGCATGATGTAGCTGATGAACCAATCTGCATGGAGCCATTCTCATTTGATTTTGAGCAACAGCAATTGGATGAAGAGCAAATAAAAGAGATGATCTACAGGGAAGCATTAGCACTGAATCCTGAGTATGCTTAA
Predicted protein sequences of Glyma12g07770
>Glyma12g07770.1   sequence type=predicted peptide   gene model=Glyma12g07770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGVNPNGVADFAAVPTHGGQFIQYNIFGNLFEVTTKYRPPIMPIGRGAYGIVCSLLNTETNELVAVKKIANAFDNHMDAKRTLREIKLLRHLDHENVIGLRDVIPPPLRREFNDVYIATELMDTDLHHIIRSNQNLSEEHCQYFLYQILRGLKYIHSANVIHRDLKPSNLLLNSNCDLKIIDFGLARPTLESDFMTEYVVTRWYRAPELLLNSSDYTSAIDVWSVGCIFMELMNKKPLFPGKDHVHQMRLLTELLGTPTEADLGLVKNEDARRYIRQLPQYPRQPLAQVFPHVHPAAIDLVDKMLTVDPTKRITVEEALAHPYLEKLHDVADEPICMEPFSFDFEQQQLDEEQIKEMIYREALALNPEYA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo