Glyma12g07500 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g07500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g07500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g07500

Feature Type:	gene_model
Chromosome:	Gm12
Start:	5126031
stop:	5128897
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g07500

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G28470	AT	Annotation by Michelle Graham. TAIR10: beta-galactosidase 8 \| chr2:12169047-12173164 REVERSE LENGTH=852	SoyBase	E_val: 2.00E-96	ISS
GO:0005975	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005618	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell wall	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0004553	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds	SoyBase	N/A	ISS
GO:0004565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: beta-galactosidase activity	SoyBase	N/A	ISS
GO:0030246	GO-mf	Annotation by Michelle Graham. GO Molecular Function: carbohydrate binding	SoyBase	N/A	ISS
GO:0043169	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cation binding	SoyBase	N/A	ISS
PTHR23421	Panther	BETA-GALACTOSIDASE RELATED	JGI		ISS
PTHR23421:SF31	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF01301	PFAM	Glycosyl hydrolases family 35	JGI		ISS
UniRef100_I1LL69	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Beta-galactosidase n=1 Tax=Glycine max RepID=I1LL69_SOYBN	SoyBase	E_val: 2.00E-127	ISS
UniRef100_UPI000233C174	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233C174 related cluster n=1 Tax=unknown RepID=UPI000233C174	SoyBase	E_val: 4.00E-166	ISS

Expression Patterns of Glyma12g07500

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g07500 not represented in the dataset	Glyma12g07500 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma12g07500 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma12g07500

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g07500

Limit To All Plant Sequences

>Glyma12g07500.1   sequence type=CDS   gene model=Glyma12g07500   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TACAAACAAAATTCCGATAGATTCGATACTCGAACTTTTGAGTATTTTACTACTTATAACAAATTTGGGACACTTTTATTTGAATGTTTGTTTCATTTGGTGATGTTGTGCCTCACAGACCAGTGGAAGATCTTGCATTTGCTGTGGCACGCTTTTACCAGCGAGTACCATGGAGGGACTAATTTTGGCCGAACTACTGGTGGACCTTTCATTTCTACTAGTTATGATTTTGATACACCAATTGATGAGTATGGAATTATTAGACAGCCTAAGTGGGACCACCTTAAAAATGTGCATAAGGCAATAAAACTTTGTGAAAAAGCGCTGCTAGCTACTGGTCCAACAATTACATATCTTGGACCAAATATAGAGGCTGCAGTTTACAACATAGGAGCTGTAAGTGCTGCCTTCCTTGCCAACATTGCCAAAACTGATGCAAAAGTAAGCTTCAATGGAAATTCATATCACTTGCCCGCATGGTATGTGAGCACCTTACCAGACTGCAAGAGTGTAGTGCTTAATACCGCAAAGATTAACTCTGCATCTATGATTTCAAGCTTCACAACTGAATCTTTAAAAGAAGAGGTTGGCTCTTTGGATGATTCTGGCTCGGGATGGAGTTGGATTAGTGAACCTATCGGTATTTCAAAGGCTCATTCATTCTCAAAATTTTGGCTACTGGAGCAAATAAATACAACTGCAGATAGAAGTGATTACTTGTGGTATTCCTCAAGCATTGATCTTGATGCTGCTACTGAAACTGTCCTTCACATTGAATCCCTTGGTCATGCTCTTCATGCTTTCGTAAATGGGAAGCTTGCAGGTAACCATGAGAAAGTTAGTGTCAAAGTAGACATCCCCATCACATTA

Predicted protein sequences of Glyma12g07500

Limit To All Plant Sequences

>Glyma12g07500.1   sequence type=predicted peptide   gene model=Glyma12g07500   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
YKQNSDRFDTRTFEYFTTYNKFGTLLFECLFHLVMLCLTDQWKILHLLWHAFTSEYHGGTNFGRTTGGPFISTSYDFDTPIDEYGIIRQPKWDHLKNVHKAIKLCEKALLATGPTITYLGPNIEAAVYNIGAVSAAFLANIAKTDAKVSFNGNSYHLPAWYVSTLPDCKSVVLNTAKINSASMISSFTTESLKEEVGSLDDSGSGWSWISEPIGISKAHSFSKFWLLEQINTTADRSDYLWYSSSIDLDAATETVLHIESLGHALHAFVNGKLAGNHEKVSVKVDIPITL

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain