Glyma12g05890 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g05890

Feature Type:	gene_model
Chromosome:	Gm12
Start:	3978677
stop:	3982436
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g05890

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G20810	AT	Annotation by Michelle Graham. TAIR10: 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein \| chr3:7275814-7278144 FORWARD LENGTH=418	SoyBase	E_val: 0	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007623	GO-bp	Annotation by Michelle Graham. GO Biological Process: circadian rhythm	SoyBase	N/A	ISS
GO:0042752	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of circadian rhythm	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
KOG2132	KOG	Uncharacterized conserved protein, contains JmjC domain	JGI		ISS
PTHR12461	Panther	HYPOXIA-INDUCIBLE FACTOR 1 ALPHA INHIBITOR-RELATED	JGI		ISS
PTHR12461:SF3	Panther	UNCHARACTERIZED	JGI		ISS
PF08007	PFAM	Cupin superfamily protein	JGI		ISS
UniRef100_B9RI82	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor, putative n=1 Tax=Ricinus communis RepID=B9RI82_RICCO	SoyBase	E_val: 0	ISS
UniRef100_I1LQG9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LQG9_SOYBN	SoyBase	E_val: 0	ISS

Proteins Associated with Glyma12g05890

Locus	Gene Symbol	Protein Name
	jmjC	transcription factor; jumonji (jmjC) domain-containing protein

Expression Patterns of Glyma12g05890

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g05890

Paralog	Evidence	Comments
Glyma11g13911	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g05890 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.12g055000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma12g05890

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g05890

Limit To All Plant Sequences

>Glyma12g05890.1   sequence type=CDS   gene model=Glyma12g05890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGACCACAACTGTATCCGGCGGCGACCCTCCTTCTCGCGGTTTTGATACGCCGACGCTGGACCGGGAGGCGGCGGCGCTGCTCCACGCGATCTCCGAGCATGGCGGGTACGCGTACGTGAGCATGGCGGTGCTGGCTTCCGGCGGCGACATTCGCGCGGCGGAGGCGGCTCGGGAGATGGCGTGGGAGCAGCTGCACTCGGGTCCGTGGCACTCGGTGCTGCCGGTGTGGCGCGACGCCTACTCCATGGCGTGCCTCCACGTGGCGCGCCACCACTACGGCAACGGTGAGTTCTTGGACGCACTTAGGGTTTTGGATTTGGGAATCATCATGGGAGGCACGCTCCTCCGCAAGGATTTGGACTCCGCCATCGAGAAAGTGTCGGAACAAACACGGAGGAGCGTTAGGGTTTCTGATTTGGGGAACTCCGAACACCGACTCGTCGATCGCGAATTTGATATGGCAGAGGTGCTCCAACTTTTACCTGTGAAGTCTCTTTCTACGAAACTTGTGGTGAAGAAATCGGCGCTGTCCTTGGAGAAATTCCTGAAGGATCATTACCTGTCTGGCTGCCCGGTTATTATCAGTGATTGTATGTCTCACTGGCCAGCCAAGATGAAATGGAATGACGAAGATTACTTGCTGAGAGTTGCCGGAGACCGTACAGTTCCAGTTGAGGTTGGGAAAAACTATTTATGTACTGAGTGGAAGCAAGAGCTAATTACTTTTTCAGAGTTTCTTCAGCGGATAAAGTCTGATAGCTGTTCTCCTGGTGGTCCTACATATCTTGCTCAGCATCCATTATTTGATCAGATAAATGAGCTTCGGAAAGATATCTTTATTCCTGACTATTGTTTTACTGGTGGAGGGGAGCTACGATCTCTCAATGCTTGGTTTGGTCCAGCAGGAACAGTAACACCGTTACACCATGATCCACATCATAACATACTAGCTCAGGTTGTTGGAAAGAAATACATTAGGCTATACTCTTCGTCTTTATCTGAGGAACTTTCCCCCCACTCTGGTACCATGCTCCACAACTCCAGCCAGGTTGATTTAGATGATATGGATGAAAAGAAGTTTCCGAAGGTGCAAGACTTGGAATTTGTAGACTGTATTTTAGAGGAAGGCGAAATGTTATATATCCCGCCAAAATGGTGGCACTATGTGCGGTCTTTGACTACCAGTTTTTCGGTTAGCTTTTGGTGGAGTGAGGGTGAAAGTTCGGATGCATCCTAA

Predicted protein sequences of Glyma12g05890

Limit To All Plant Sequences

>Glyma12g05890.1   sequence type=predicted peptide   gene model=Glyma12g05890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSTTTVSGGDPPSRGFDTPTLDREAAALLHAISEHGGYAYVSMAVLASGGDIRAAEAAREMAWEQLHSGPWHSVLPVWRDAYSMACLHVARHHYGNGEFLDALRVLDLGIIMGGTLLRKDLDSAIEKVSEQTRRSVRVSDLGNSEHRLVDREFDMAEVLQLLPVKSLSTKLVVKKSALSLEKFLKDHYLSGCPVIISDCMSHWPAKMKWNDEDYLLRVAGDRTVPVEVGKNYLCTEWKQELITFSEFLQRIKSDSCSPGGPTYLAQHPLFDQINELRKDIFIPDYCFTGGGELRSLNAWFGPAGTVTPLHHDPHHNILAQVVGKKYIRLYSSSLSEELSPHSGTMLHNSSQVDLDDMDEKKFPKVQDLEFVDCILEEGEMLYIPPKWWHYVRSLTTSFSVSFWWSEGESSDAS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain