|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G36730 | AT | Annotation by Michelle Graham. TAIR10: G-box binding factor 1 | chr4:17309850-17311752 REVERSE LENGTH=313 | SoyBase | E_val: 1.00E-10 | ISS |
| GO:0006351 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0006355 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0010310 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process | SoyBase | N/A | ISS |
| GO:0010629 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of gene expression | SoyBase | N/A | ISS |
| GO:0090342 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of cell aging | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0005737 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm | SoyBase | N/A | ISS |
| GO:0003677 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: DNA binding | SoyBase | N/A | ISS |
| GO:0003700 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity | SoyBase | N/A | ISS |
| GO:0043565 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding | SoyBase | N/A | ISS |
| GO:0046983 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity | SoyBase | N/A | ISS |
| PF00170 | PFAM | bZIP transcription factor | JGI | ISS | |
| UniRef100_E0CQ14 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Vitis vinifera RepID=E0CQ14_VITVI | SoyBase | E_val: 1.00E-10 | ISS |
| UniRef100_Q39334 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: G-box binding factor 1B (Fragment) n=1 Tax=Brassica napus RepID=Q39334_BRANA | SoyBase | E_val: 1.00E-09 | ISS |
|
Glyma12g04933 not represented in the dataset |
Glyma12g04933 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.12g045100 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma12g04933.1 sequence type=CDS gene model=Glyma12g04933 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTGTACTACAGAAACTGCTGAAGAAAAAGAACAAAGAAGAAAACAGCAAAAGAAGATAGCATCTAAGAGATCAAGGATGAAGATAAAGATGGAACGTGAAAAGTTAATTGATTCCTTGGAGAGTCTTGATGATGAAAAGGCTGCGCTCAGGGAAGAGCTTCATGACCGTACTATTGAGTGTGAGAAGATCGAAAAAGAAAACAATGCCTTACTGGCAGAACTCATTGAGGAATATGGTGAAGAAACAATAATGAACCTTCTGAATGCACAGTCTACTGACTCAGTTGCTGGTGGTGGTCAAGGCTCAAAAAACAGTTGA
>Glyma12g04933.1 sequence type=predicted peptide gene model=Glyma12g04933 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MCTTETAEEKEQRRKQQKKIASKRSRMKIKMEREKLIDSLESLDDEKAALREELHDRTIECEKIEKENNALLAELIEEYGEETIMNLLNAQSTDSVAGGGQGSKNS*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||