SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g02650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g02650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g02650

Feature Type:gene_model
Chromosome:Gm12
Start:1731425
stop:1732084
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G53420AT Annotation by Michelle Graham. TAIR10: plasma membrane intrinsic protein 2A | chr3:19803906-19805454 REVERSE LENGTH=287 SoyBaseE_val: 4.00E-15ISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0006826GO-bp Annotation by Michelle Graham. GO Biological Process: iron ion transport SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009269GO-bp Annotation by Michelle Graham. GO Biological Process: response to desiccation SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0010106GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion starvation SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0080170GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide transmembrane transport SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0015250GO-mf Annotation by Michelle Graham. GO Molecular Function: water channel activity SoyBaseN/AISS
GO:0031625GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin protein ligase binding SoyBaseN/AISS
PF00230PFAM Major intrinsic protein JGI ISS
UniRef100_B9HRB9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Aquaporin, MIP family, PIP subfamily n=1 Tax=Populus trichocarpa RepID=B9HRB9_POPTR SoyBaseE_val: 1.00E-70ISS
UniRef100_UPI000233D869UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233D869 related cluster n=1 Tax=unknown RepID=UPI000233D869 SoyBaseE_val: 4.00E-127ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g02650 not represented in the dataset

Glyma12g02650 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g023700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma12g02650.2   sequence type=CDS   gene model=Glyma12g02650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTCCCGTTTTCACATTCATTGCTGCTTTAAAGGGTGTTGTGACTCTCACCCGCGCCCTCATTTACGTGTTAGCACAATTATGCATTGGCTCAATAATTGGTTTCTTTATACTAAAGTGTGTCATGGACCCAAAATTAGCTTACACATATTCCTTGGGAGGTTGTGCCATCGATGGCCAAGGAGCGAATTCTGGTTTTAAGCCACAAGATGCTTTGTTAGTGGAATTCACTTGCACATTTGTGGTACTCTTTGGGGCGGTAACATTGGCATTTGACAAGAAAAGGTCTAGGGATTTGGGCTTGCTAATGGTGTGCTTACTGGTGGCAGGAGCCATGGCATTGGCAGCATTTGTGTCCATAACTTTAACTGGGCAGGCCAGTTATGCAGGTGTGGGCCTGAACCCAGCAAGATGCCTAGGCCCAGCATTGCTTCATGGAGGATCACTTTGGGAAGGGCATTGGGTTTTGTGGCTTGGGTCTTTCTTGGCATGTGTAGTCTATTATGCTGTGTCTATCAACCTTGCAAAGGAGGGTTTGGTTTGGGTAGATGGAGAATATGATATGTTGGCTCTCGGTTCTTGTGGGAATGTCTATAATACTTCCGTTTTAAAGGATCAACTAGAAGAACGAAGTGCTGGGTTCCAAGTCCAAGTATGA

>Glyma12g02650.2   sequence type=predicted peptide   gene model=Glyma12g02650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSPVFTFIAALKGVVTLTRALIYVLAQLCIGSIIGFFILKCVMDPKLAYTYSLGGCAIDGQGANSGFKPQDALLVEFTCTFVVLFGAVTLAFDKKRSRDLGLLMVCLLVAGAMALAAFVSITLTGQASYAGVGLNPARCLGPALLHGGSLWEGHWVLWLGSFLACVVYYAVSINLAKEGLVWVDGEYDMLALGSCGNVYNTSVLKDQLEERSAGFQVQV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo