SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g00901): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g00901): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g00901

Feature Type:gene_model
Chromosome:Gm12
Start:484421
stop:488429
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G07660AT Annotation by Michelle Graham. TAIR10: structural maintenance of chromosomes 6A | chr5:2422839-2429912 FORWARD LENGTH=1058 SoyBaseE_val: 1.00E-89ISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0006261GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006346GO-bp Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing SoyBaseN/AISS
GO:0007059GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome segregation SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0007267GO-bp Annotation by Michelle Graham. GO Biological Process: cell-cell signaling SoyBaseN/AISS
GO:0009616GO-bp Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing SoyBaseN/AISS
GO:0010165GO-bp Annotation by Michelle Graham. GO Biological Process: response to X-ray SoyBaseN/AISS
GO:0010267GO-bp Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0051276GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome organization SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005694GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chromosome SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0000155GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphorelay sensor kinase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
PTHR19306Panther STRUCTURAL MAINTENANCE OF CHROMOSOMES 5,6 (SMC5, SMC6) JGI ISS
PTHR19306:SF2Panther gb def: putative nuclear protein of the smc family [encephalitozoon cuniculi] JGI ISS
PF02463PFAM RecF/RecN/SMC N terminal domain JGI ISS
UniRef100_G7JRH6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Structural maintenance of chromosomes protein n=1 Tax=Medicago truncatula RepID=G7JRH6_MEDTR SoyBaseE_val: 3.00E-95ISS
UniRef100_UPI0002338315UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002338315 related cluster n=1 Tax=unknown RepID=UPI0002338315 SoyBaseE_val: 2.00E-118ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g00901 not represented in the dataset

Glyma12g00901 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma09g36430 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g006400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma12g00901.1   sequence type=CDS   gene model=Glyma12g00901   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTTCCCACACTCTTCATCAACCCACCGCAGGCATCGTCAAGCAACTTCGACTCGAGAACTTCATGTGCCATTCCAAACACGAGACCGAGTTCGGAAACCACGTCAATTTCATCACCGGTCAAAACGGAAGTGGTAAGAGTACAATCCTAGCTGCACTGTGTGTTGCATTTGGCTGTCGAGCCAAAGAGACTCAAAGGACTTCCACTTTGAAGGATTTCATTAAAACTGGCGCCACTGATGCTGTCATCCAAGTTGAAATTCAAAATGAAGGGGAGGGTGCTTTTAAACCTGAAATATATGGTCCTGTTATCATCGTAGAACGTAGGATATCTGAATCAACAAGTTCTGCTACATTAAAAGACCACCAAGGAAGGAAGGTTGTCAGTTGGAAAACAGATCTTCTAGAAATCGTTGAACATTTTAATATTGATGTGGAGAATCCATGTGTAATTATGAATCAAGACAAAAGCAGAGAATTTTTGCATTCTGGGAATAACAAAGATAAATTTAAGTTCTTTTACAAGGTCACGCTTCTTCAGCAAGTCAATGATCTTCTGGAAAGCATTTCCCACAGAGGGGCATTTTATGGTAGCGGTTTTGGGTAA

>Glyma12g00901.1   sequence type=predicted peptide   gene model=Glyma12g00901   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVSHTLHQPTAGIVKQLRLENFMCHSKHETEFGNHVNFITGQNGSGKSTILAALCVAFGCRAKETQRTSTLKDFIKTGATDAVIQVEIQNEGEGAFKPEIYGPVIIVERRISESTSSATLKDHQGRKVVSWKTDLLEIVEHFNIDVENPCVIMNQDKSREFLHSGNNKDKFKFFYKVTLLQQVNDLLESISHRGAFYGSGFG*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo