SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma11g35610

Feature Type:gene_model
Chromosome:Gm11
Start:37242671
stop:37246373
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g35610
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G40300AT Annotation by Michelle Graham. TAIR10: ferritin 4 | chr2:16831501-16833214 REVERSE LENGTH=259 SoyBaseE_val: 2.00E-127ISS
GO:0000302GO-bp Annotation by Michelle Graham. GO Biological Process: response to reactive oxygen species SoyBaseN/AISS
GO:0006826GO-bp Annotation by Michelle Graham. GO Biological Process: iron ion transport SoyBaseN/AISS
GO:0006879GO-bp Annotation by Michelle Graham. GO Biological Process: cellular iron ion homeostasis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009908GO-bp Annotation by Michelle Graham. GO Biological Process: flower development SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010039GO-bp Annotation by Michelle Graham. GO Biological Process: response to iron ion SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0055072GO-bp Annotation by Michelle Graham. GO Biological Process: iron ion homeostasis SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0008199GO-mf Annotation by Michelle Graham. GO Molecular Function: ferric iron binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0046914GO-mf Annotation by Michelle Graham. GO Molecular Function: transition metal ion binding SoyBaseN/AISS
KOG2332 KOG Ferritin JGI ISS
PTHR11431Panther FERRITIN JGI ISS
PTHR11431:SF8Panther FERRITIN LIGHT CHAIN JGI ISS
PF00210PFAM Ferritin-like domain JGI ISS
UniRef100_Q948P6UniRef Annotation by Michelle Graham. Best UniRef hit: Ferritin-3, chloroplastic n=1 Tax=Glycine max RepID=FRI3_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q948P6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ferritin-3, chloroplastic n=1 Tax=Glycine max RepID=FRI3_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma11g35610
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g35610
ParalogEvidenceComments
Glyma18g02800 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g35610 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g232600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g35610
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g35610
>Glyma11g35610.1   sequence type=CDS   gene model=Glyma11g35610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTTCTCAGAACAGCTTCATCTTTCTCTCTCCTCAAAGCCAACGCCGACCATATACTCCCTCTCCCCAACTCTTCTTCTTCTGGTATTATTCGCTACTCTCAGTCTCTGGGGAAAAACTTGGTTCCATGCGCTACCAAGGACACCAACAACCGCCCCTTAACCGGCGTCGTTTTTGAACCCTTTGAAGAGGTCAAGAAGGAGCTCGACCTTGTTCCCACCGTCCCACAAGCTTCCCTCGCTCGCCAGAAATACACCGATGACTGCGAGGCTACCATAAACGAACAGATCAATGTGGAGTACAATGTTTCGTATGTTTATCATGCGATGTTTGCCTACTTCGATAGGGACAATGTCGCGCTCAAGGGTCTTGCCAAGTTTTTCAAGGAGTCAAGCGAGGAGGAAAGGGAGCATGCTGAGAAATTAATGGAATATCAAAACAAACGAGGTGGAAAAGTGAAGTTGCAATCCATAGTGATGCCTCTTTCTGAGTTTGACCATGAGGAAAAGGGAGATGCCCTGTATGCAATGGAACTTGCTCTGTCGTTGGAGAAGCTAACCAATGAAAAATTACTTAACTTGCACAGTGTTGCCTCAAAGAACAATGATGTGCAATTGGCAGATTTTATTGAAAGCGAGTTTTTGGGTGAACAGGTGGAAGCCATAAAAAAAATCTCTGAGTACGTTGCTCAGCTCAGAAGAGTTGGTAAAGGACATGGTGTGTGGCACTTTGATCAGATGCTGCTGCATGAGGAGGGCGTTGCTGCTTGA
Predicted protein sequences of Glyma11g35610
>Glyma11g35610.1   sequence type=predicted peptide   gene model=Glyma11g35610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLLRTASSFSLLKANADHILPLPNSSSSGIIRYSQSLGKNLVPCATKDTNNRPLTGVVFEPFEEVKKELDLVPTVPQASLARQKYTDDCEATINEQINVEYNVSYVYHAMFAYFDRDNVALKGLAKFFKESSEEEREHAEKLMEYQNKRGGKVKLQSIVMPLSEFDHEEKGDALYAMELALSLEKLTNEKLLNLHSVASKNNDVQLADFIESEFLGEQVEAIKKISEYVAQLRRVGKGHGVWHFDQMLLHEEGVAA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo