Report for Sequence Feature Glyma11g33760
Feature Type: gene_model
Chromosome: Gm11
Start: 35629499
stop: 35632037
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma11g33760
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G17980 AT
Annotation by Michelle Graham. TAIR10: Calcium-dependent lipid-binding (CaLB domain) family protein | chr3:6152417-6153115 FORWARD LENGTH=177
SoyBase E_val: 6.00E-81 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
KOG1030
KOG
Predicted Ca2+-dependent phospholipid-binding protein
JGI ISS
PTHR26357 Panther
FAMILY NOT NAMED
JGI ISS
PTHR26357:SF5 Panther
JGI ISS
PF00168 PFAM
C2 domain
JGI ISS
UniRef100_B9T6Z1 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: ARF GTPase activator, putative n=1 Tax=Ricinus communis RepID=B9T6Z1_RICCO
SoyBase E_val: 3.00E-85 ISS
UniRef100_C6SYG2 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SYG2_SOYBN
SoyBase E_val: 8.00E-116 ISS
Expression Patterns of Glyma11g33760
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma11g33760
Paralog Evidence Comments
Glyma18g04470 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma11g33760 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.11g216900 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma11g33760
Coding sequences of Glyma11g33760
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma11g33760.1 sequence type=CDS gene model=Glyma11g33760 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGAGAACTTGTTGGGTCTGCTGAGAATTCATGTTGAAAAAGGTGTCAATCTTGCCATCAGGGATGTGGTGAGCAGTGACCCTTATGTTGTCATCAAAATGGGCAAGCAGAAGCTGAAGACTCGGGTAGTCAATAAGAATCTAAATCCTGAATGGAATGATGACTTGACCTTGTCTATCTCTGACCCTCATGCTCCAATTCATCTACATGTGTATGACAAGGACACATTTAGCATGGATGACAAAATGGGGGATGCAGAGTTTTTCATAGGTCCATTTATTGAAGCAGTGAAGATGCGCTTATCAAGTCTCCCCAACAATACTATAGTTACAAAAGTGCTACCTAGCAGACAAAACAGTTTAGCTGAAGAGAGTCACATTGTGTGGAAGGATGGCAAAGTTGTCCAAAACATGGTTCTTAGACTAAGAAATGTTGAGACTGGGGAAGTGGAGCTCCAGTTGCATTGGATTGACATTCCTGGTTCAAGGCATCTCTAG
Predicted protein sequences of Glyma11g33760
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma11g33760.1 sequence type=predicted peptide gene model=Glyma11g33760 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MENLLGLLRIHVEKGVNLAIRDVVSSDPYVVIKMGKQKLKTRVVNKNLNPEWNDDLTLSISDPHAPIHLHVYDKDTFSMDDKMGDAEFFIGPFIEAVKMRLSSLPNNTIVTKVLPSRQNSLAEESHIVWKDGKVVQNMVLRLRNVETGEVELQLHWIDIPGSRHL*