Glyma11g32827 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g32827): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g32827): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g32827

Feature Type:	gene_model
Chromosome:	Gm11
Start:	34621884
stop:	34622311
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g32827

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G04800	AT	Annotation by Michelle Graham. TAIR10: Ribosomal S17 family protein \| chr5:1389217-1389642 FORWARD LENGTH=141	SoyBase	E_val: 3.00E-32	ISS
GO:0000028	GO-bp	Annotation by Michelle Graham. GO Biological Process: ribosomal small subunit assembly	SoyBase	N/A	ISS
GO:0006412	GO-bp	Annotation by Michelle Graham. GO Biological Process: translation	SoyBase	N/A	ISS
GO:0006414	GO-bp	Annotation by Michelle Graham. GO Biological Process: translational elongation	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005840	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: ribosome	SoyBase	N/A	ISS
GO:0022627	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosolic small ribosomal subunit	SoyBase	N/A	ISS
GO:0003735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome	SoyBase	N/A	ISS
KOG0187	KOG	40S ribosomal protein S17	JGI		ISS
PTHR10732	Panther	40S RIBOSOMAL PROTEIN S17	JGI		ISS
PF00833	PFAM	Ribosomal S17	JGI		ISS
UniRef100_I3NMJ2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 40S ribosomal protein S17C n=1 Tax=Hevea brasiliensis RepID=I3NMJ2_HEVBR	SoyBase	E_val: 2.00E-33	ISS
UniRef100_UPI000233CE3E	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233CE3E related cluster n=1 Tax=unknown RepID=UPI000233CE3E	SoyBase	E_val: 4.00E-52	ISS

Expression Patterns of Glyma11g32827

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g32827 not represented in the dataset	Glyma11g32827 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g32827 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.11g208000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma11g32827

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g32827

Limit To All Plant Sequences

>Glyma11g32827.1   sequence type=CDS   gene model=Glyma11g32827   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACCCTGGACTTCCATACGAACAAGAAGCTTCTGGAGGAAGTGGCGATAATCCCATCAAAGAGGCTAAGGAACAAGATCGAGGAGGAGCGCGAGTGCCGCATGGACTTCGTCCCCGACGTCTTCGCCATCAACACCGACCACATCGAGGTCGACAAGGAAACCCTCGACATGCTCCACTCCCTCGGTATCAATGACATCCCCGGTATCACCCAGGTTGACCCTGTCCCTGTTCAGCAGAGCTTCCCCTTCACCAGGAGGTATTGA

Predicted protein sequences of Glyma11g32827

Limit To All Plant Sequences

>Glyma11g32827.1   sequence type=predicted peptide   gene model=Glyma11g32827   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTLDFHTNKKLLEEVAIIPSKRLRNKIEEERECRMDFVPDVFAINTDHIEVDKETLDMLHSLGINDIPGITQVDPVPVQQSFPFTRRY*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain