SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g32330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g32330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g32330

Feature Type:gene_model
Chromosome:Gm11
Start:33879788
stop:33881053
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g32330
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G02390AT Annotation by Michelle Graham. TAIR10: glutathione S-transferase zeta 1 | chr2:629015-630607 FORWARD LENGTH=191 SoyBaseE_val: 7.00E-40ISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0009072GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process SoyBaseN/AISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004364GO-mf Annotation by Michelle Graham. GO Molecular Function: glutathione transferase activity SoyBaseN/AISS
PTHR11260Panther GLUTATHIONE S-TRANSFERASE, GST, SUPERFAMILY, GST DOMAIN CONTAINING JGI ISS
PTHR11260:SF24Panther SUBFAMILY NOT NAMED JGI ISS
PF02798PFAM Glutathione S-transferase, N-terminal domain JGI ISS
UniRef100_I1LM43UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1LM43_SOYBN SoyBaseE_val: 8.00E-106ISS
UniRef100_P57108UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glutathione S-transferase zeta class n=1 Tax=Euphorbia esula RepID=GSTZ_EUPES SoyBaseE_val: 4.00E-42ISS

Expression Patterns of Glyma11g32330
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g32330 not represented in the dataset
Glyma11g32330 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g32330 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma11g32330
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g32330
>Glyma11g32330.1   sequence type=CDS   gene model=Glyma11g32330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GAAACTGTATTCGTACTGCATAAGCACGCCTTTCGAGTTCGATTTGCTCTCAACCTCAAAGGACTACCTTACGATTACCTAGCAATCACATCATTTTCTGACCTTGATCAATTCGATTTCCTCTTTTACCTATGTTCAAAGTTTCTTAAGCTCAACCCCATTGGATTTGTTCCCGTGTTGGTCGATGGAGATTCAGTAATTGTTGACTCTCTTGCCATTATTATGTATTTGGAAGATAAGTATCTTGACCCTCCTCAGCTTCCTCATGATATTCACCAAAGAGCCATCAATTTCCAAGCTGCCACTATTGTTTCCTCATCTATACAGCCTTTTCAAAATTATACTTTAAAGTACATAGGGGAAAAAGTTGGCGCTGATGAAAAGCTTCCTTGGACCCAAAGTGTAATTGGAAAAAGCTTTATGGTTTTTCAAAACTATCAAACATTTATTAACTGA
Predicted protein sequences of Glyma11g32330
>Glyma11g32330.1   sequence type=predicted peptide   gene model=Glyma11g32330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ETVFVLHKHAFRVRFALNLKGLPYDYLAITSFSDLDQFDFLFYLCSKFLKLNPIGFVPVLVDGDSVIVDSLAIIMYLEDKYLDPPQLPHDIHQRAINFQAATIVSSSIQPFQNYTLKYIGEKVGADEKLPWTQSVIGKSFMVFQNYQTFIN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo