Glyma11g29950 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g29950): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g29950): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g29950

Feature Type:	gene_model
Chromosome:	Gm11
Start:	30873442
stop:	30874692
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g29950

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G33950	AT	Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein \| chr4:16272819-16274657 FORWARD LENGTH=314	SoyBase	E_val: 9.00E-19	ISS
GO:0005985	GO-bp	Annotation by Michelle Graham. GO Biological Process: sucrose metabolic process	SoyBase	N/A	ISS
GO:0006468	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein phosphorylation	SoyBase	N/A	ISS
GO:0006636	GO-bp	Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process	SoyBase	N/A	ISS
GO:0006970	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to osmotic stress	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009737	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0009738	GO-bp	Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010118	GO-bp	Annotation by Michelle Graham. GO Biological Process: stomatal movement	SoyBase	N/A	ISS
GO:0010119	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement	SoyBase	N/A	ISS
GO:0019432	GO-bp	Annotation by Michelle Graham. GO Biological Process: triglyceride biosynthetic process	SoyBase	N/A	ISS
GO:0040007	GO-bp	Annotation by Michelle Graham. GO Biological Process: growth	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0042744	GO-bp	Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process	SoyBase	N/A	ISS
GO:0048366	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf development	SoyBase	N/A	ISS
GO:2000377	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of reactive oxygen species metabolic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0004672	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein kinase activity	SoyBase	N/A	ISS
GO:0004674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity	SoyBase	N/A	ISS
GO:0004713	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0009931	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium-dependent protein serine/threonine kinase activity	SoyBase	N/A	ISS
GO:0016301	GO-mf	Annotation by Michelle Graham. GO Molecular Function: kinase activity	SoyBase	N/A	ISS
GO:0016772	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups	SoyBase	N/A	ISS
PTHR24343	Panther	SERINE/THREONINE KINASE	JGI		ISS
PTHR24343:SF58	Panther	SUBFAMILY NOT NAMED	JGI		ISS
UniRef100_I1KL27	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KL27_SOYBN	SoyBase	E_val: 2.00E-17	ISS
UniRef100_UPI0002348173	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Serine/threonine-protein kinase SRK2E n=1 Tax=Arabidopsis thaliana RepID=UPI0002348173	SoyBase	E_val: 2.00E-16	ISS

Expression Patterns of Glyma11g29950

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g29950 not represented in the dataset	Glyma11g29950 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g29950 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.11g161700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma11g29950

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g29950

Limit To All Plant Sequences

>Glyma11g29950.1   sequence type=CDS   gene model=Glyma11g29950   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACTCAGATTGCAGATGTGCGGTCTTGTGGGGTGACCTTATATGTCATTGTGAGGATTTTGAATGTTCAATACTCAATTCCTGACTATGTTCATATATCTTCCGAGTGTCGTCATCTGCTATCAAGGATTTTTGTAGCTGATCCTGCAAAGATGCCGTCTCATGGCTGCACAAGTAGAAACTATCTTATTTGGTGTCTACATAATCATTTTCTTGAAAATTTATTTGCCTTTCTGTTTATTTCTAGACCCAAAATTTGGATACTTTTTTTGGAGTTGATAACATATATAATATATAATATTCTCCTTTGTAATGGAACAATCGTGGCAGCTTCAAGATTCATTCATTCATACTCATCGTAA

Predicted protein sequences of Glyma11g29950

Limit To All Plant Sequences

>Glyma11g29950.1   sequence type=predicted peptide   gene model=Glyma11g29950   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTQIADVRSCGVTLYVIVRILNVQYSIPDYVHISSECRHLLSRIFVADPAKMPSHGCTSRNYLIWCLHNHFLENLFAFLFISRPKIWILFLELITYIIYNILLCNGTIVAASRFIHSYSS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain