Glyma11g28440 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma11g28440

Feature Type:	gene_model
Chromosome:	Gm11
Start:	28570324
stop:	28571884
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g28440

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G65140	AT	Annotation by Michelle Graham. TAIR10: Haloacid dehalogenase-like hydrolase (HAD) superfamily protein \| chr5:26019878-26022077 REVERSE LENGTH=370	SoyBase	E_val: 2.00E-84	ISS
GO:0005992	GO-bp	Annotation by Michelle Graham. GO Biological Process: trehalose biosynthetic process	SoyBase	N/A	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0004805	GO-mf	Annotation by Michelle Graham. GO Molecular Function: trehalose-phosphatase activity	SoyBase	N/A	ISS
PTHR10788	Panther	TREHALOSE-6-PHOSPHATE SYNTHASE	JGI		ISS
PF02358	PFAM	Trehalose-phosphatase	JGI		ISS
UniRef100_B9RJH8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Trehalose-6-phosphate synthase, putative n=1 Tax=Ricinus communis RepID=B9RJH8_RICCO	SoyBase	E_val: 1.00E-91	ISS
UniRef100_I1LLP5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1LLP5_SOYBN	SoyBase	E_val: 7.00E-127	ISS

Expression Patterns of Glyma11g28440

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g28440 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.11g168300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma11g28440

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g28440

Limit To All Plant Sequences

>Glyma11g28440.2   sequence type=CDS   gene model=Glyma11g28440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCCAAATTTTGCTGCACTCAGTTAGGTGTCAGTCTTTCCACAATATATAGTGCCAAAGGAAAGCAAATTATAGTTTTTCTTGACTACGATGGAACTCTCTCTCCAATTGTTGCAGATCTAGATAAGGCTTTCATGACTAGAAAGACGAGAGCAACACTAAAGGGTATAGCAAGACATTTTCCCATAGCAATCGTGATCGGAAGGTGCAGAGACAAGGTATATAACTTTGTAAAATTGGCAGAACTTGGCATGGACATCACTGGTCCAACAAAAAGTCCAAAATCAACAGTGCTGTTCCAATCCACGAGTCAATTCCTGCCAATGATCGATGAGGTGTACAAGATCTTGTTAGAAAAAATGAAGACTGTCCCAGGGGCCCTAAGGTTGAGAACAATAAGTTTTAGTTGGGCAGCGTTGGCGGAGAAAGTTAGATTGGTGCTCAATGAGTATCCACAACTCAGGCTAACCCAAGGGAGAAAAGTGCTAGAGATCCATCCAACCATCAAATGGGACAAGGGCAAGGCTCTTGAATTTTTGTTAGAATCATTAGGGTACAAGAATTTGAATGATATATTTCCAATCTATATTGGTGATGATCGAACTGATGAGGATGCTTTTAGGGTTTTGCGCAGTAGGGGTTAA

Predicted protein sequences of Glyma11g28440

Limit To All Plant Sequences

>Glyma11g28440.2   sequence type=predicted peptide   gene model=Glyma11g28440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSKFCCTQLGVSLSTIYSAKGKQIIVFLDYDGTLSPIVADLDKAFMTRKTRATLKGIARHFPIAIVIGRCRDKVYNFVKLAELGMDITGPTKSPKSTVLFQSTSQFLPMIDEVYKILLEKMKTVPGALRLRTISFSWAALAEKVRLVLNEYPQLRLTQGRKVLEIHPTIKWDKGKALEFLLESLGYKNLNDIFPIYIGDDRTDEDAFRVLRSRG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain