Report for Sequence Feature Glyma11g27880
Feature Type: gene_model
Chromosome: Gm11
Start: 27793902
stop: 27796390
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma11g27880
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G16720 AT
Annotation by Michelle Graham. TAIR10: TOXICOS EN LEVADURA 2 | chr3:5692880-5693794 FORWARD LENGTH=304
SoyBase E_val: 9.00E-28 ISS
GO:0000165 GO-bp
Annotation by Michelle Graham. GO Biological Process: MAPK cascade
SoyBase N/A ISS
GO:0002679 GO-bp
Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response
SoyBase N/A ISS
GO:0006612 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane
SoyBase N/A ISS
GO:0006952 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response
SoyBase N/A ISS
GO:0009595 GO-bp
Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus
SoyBase N/A ISS
GO:0009611 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to wounding
SoyBase N/A ISS
GO:0009612 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to mechanical stimulus
SoyBase N/A ISS
GO:0009697 GO-bp
Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process
SoyBase N/A ISS
GO:0009814 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction
SoyBase N/A ISS
GO:0009862 GO-bp
Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway
SoyBase N/A ISS
GO:0009867 GO-bp
Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway
SoyBase N/A ISS
GO:0010200 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to chitin
SoyBase N/A ISS
GO:0010310 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process
SoyBase N/A ISS
GO:0010363 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response
SoyBase N/A ISS
GO:0031348 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response
SoyBase N/A ISS
GO:0035556 GO-bp
Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction
SoyBase N/A ISS
GO:0042742 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to bacterium
SoyBase N/A ISS
GO:0043900 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process
SoyBase N/A ISS
GO:0050832 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to fungus
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0008270 GO-mf
Annotation by Michelle Graham. GO Molecular Function: zinc ion binding
SoyBase N/A ISS
PTHR22764 Panther
RING FINGER PROTEIN 11 (SID 1669) (NEDD4 WW DOMAIN-BINDING PROTEIN 2).
JGI ISS
PF00097 PFAM
Zinc finger, C3HC4 type (RING finger)
JGI ISS
UniRef100_G7K734 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: RING-H2 zinc finger protein n=1 Tax=Medicago truncatula RepID=G7K734_MEDTR
SoyBase E_val: 2.00E-38 ISS
UniRef100_UPI000233E9EB UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233E9EB related cluster n=1 Tax=unknown RepID=UPI000233E9EB
SoyBase E_val: 4.00E-119 ISS
Expression Patterns of Glyma11g27880
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma11g27880
Paralog Evidence Comments
Glyma18g06760 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma11g27880 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.11g169600 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma11g27880
Coding sequences of Glyma11g27880
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma11g27880.2 sequence type=CDS gene model=Glyma11g27880 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGATTGTGAACCACCACCCTCCTAATAAAACCCATCAAGTCCAAACCTTTGAGCCAAAACCAAAACATCCTTTTGGCCACACTCTCCACAACACAATTATGCCAACCCAACCAGATTCACCACCCAACAACAACACGTTGACCCAAATGTTTCAGAACATCTTCTCAGACAACAGTAACATCATGCTTGCAGCCATCATTTCCCTTCTCTTAGTAATCCTCTTTGTCCTTCTTCTTCACCTCTACGCCAAGTGGTTCCTCGCTCAAGCACAGGCTCAGGCCAACGCCCGCCGCCGGAGGCGGCGCCGTCGCACGACGGTGACCGTCTCCGACGTCCTAGGCCCGGCAAGGTTCCACCACTTCCACAGCTTCACCATAGAAGACAGTTCACCCCTCTCAACAAAAGGGTTAGATTCTTCAACCATTAGAACAATTCCACTGTTCATCTATGAACACAACAACAACAACAACAAAAAGGTCGAAGAAGAAGAAGAAGAACTTGAATGTGTGATTTGTTTGAGTGCATTTAAGAATGGTGAAGTGGGAAGGTGTTTGCCAAAGTGTGGCCATGGCTTCCATGTGGAGTGCATTGACATGTGGTTGAGTTCACACTCCAATTGTCCTATTTGTAGAACCTCAATTGTAGCAAGTATTGTGGAAAATAATTCTAGTGATGATCATCATGGTGGAGATCATGATTTGGTTGAGATTGTGACTGAAGGTGGTTCTGCTGCTCCAAGTTTTGAGACTAGAGAGGGTGAACATGGGAATAGTAATAATGGAAATGGAGGAGCAAGAACAAGTGTTTCTGTTGTGTCAGAAAATTCTTCTTCTGAGTTCTTTGGATGCTCTTTGGAGAGAATGCTTGGCAAGGTTTTCCCAATATCAAGTAATGTTAATTAA
Predicted protein sequences of Glyma11g27880
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma11g27880.2 sequence type=predicted peptide gene model=Glyma11g27880 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MIVNHHPPNKTHQVQTFEPKPKHPFGHTLHNTIMPTQPDSPPNNNTLTQMFQNIFSDNSNIMLAAIISLLLVILFVLLLHLYAKWFLAQAQAQANARRRRRRRRTTVTVSDVLGPARFHHFHSFTIEDSSPLSTKGLDSSTIRTIPLFIYEHNNNNNKKVEEEEEELECVICLSAFKNGEVGRCLPKCGHGFHVECIDMWLSSHSNCPICRTSIVASIVENNSSDDHHGGDHDLVEIVTEGGSAAPSFETREGEHGNSNNGNGGARTSVSVVSENSSSEFFGCSLERMLGKVFPISSNVN*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
