Glyma11g25250 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g25250): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g25250): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g25250

Feature Type:	gene_model
Chromosome:	Gm11
Start:	23346110
stop:	23359850
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g25250

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G38170	AT	Annotation by Michelle Graham. TAIR10: cation exchanger 1 \| chr2:15989429-15993178 REVERSE LENGTH=463	SoyBase	E_val: 3.00E-113	ISS
GO:0006812	GO-bp	Annotation by Michelle Graham. GO Biological Process: cation transport	SoyBase	N/A	ISS
GO:0006816	GO-bp	Annotation by Michelle Graham. GO Biological Process: calcium ion transport	SoyBase	N/A	ISS
GO:0006833	GO-bp	Annotation by Michelle Graham. GO Biological Process: water transport	SoyBase	N/A	ISS
GO:0006882	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular zinc ion homeostasis	SoyBase	N/A	ISS
GO:0007030	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi organization	SoyBase	N/A	ISS
GO:0009624	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nematode	SoyBase	N/A	ISS
GO:0009631	GO-bp	Annotation by Michelle Graham. GO Biological Process: cold acclimation	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009750	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus	SoyBase	N/A	ISS
GO:0019761	GO-bp	Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process	SoyBase	N/A	ISS
GO:0030003	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis	SoyBase	N/A	ISS
GO:0030026	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular manganese ion homeostasis	SoyBase	N/A	ISS
GO:0032880	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of protein localization	SoyBase	N/A	ISS
GO:0044242	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular lipid catabolic process	SoyBase	N/A	ISS
GO:0055062	GO-bp	Annotation by Michelle Graham. GO Biological Process: phosphate ion homeostasis	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0070838	GO-bp	Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005774	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009705	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0008324	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cation transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015085	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium ion transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015368	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium:cation antiporter activity	SoyBase	N/A	ISS
GO:0015369	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium:hydrogen antiporter activity	SoyBase	N/A	ISS
KOG1397	KOG	Ca2+/H+ antiporter VCX1 and related proteins	JGI		ISS
PF01699	PFAM	Sodium/calcium exchanger protein	JGI		ISS
UniRef100_G7KE49	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Vacuolar cation/proton exchanger n=1 Tax=Medicago truncatula RepID=G7KE49_MEDTR	SoyBase	E_val: 8.00E-136	ISS
UniRef100_I1LLF7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1LLF7_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma11g25250

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g25250 not represented in the dataset	Glyma11g25250 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g25250 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma11g25250

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g25250

Limit To All Plant Sequences

>Glyma11g25250.1   sequence type=CDS   gene model=Glyma11g25250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CCTTGGATTTTTGCTTGGAGCCTACTTGGACTCACCCCTCTAGCTGAACGTGTCAGCTTCTTTACTGATTGGAGGGCTTCTGAATGCAACCTGTGGAAATGCAACCCAGATGATCATATCTCTGTTAGCACTTCACCAAAACAAAGTAAATGTTGTGAAGTTCTCTCTGCTGGGATCCATTCTCTCAAACCTTCTATTACCAATCTTAGGAAGGAGCAACGATATGACAAAAAAGAGGCAGATGTAAACTCACTGCTTTTGTTGCTGGGGTTGCTATGCCATTTGCTGCCATTACTACTCAGATATGCCTTAGCAGGGGAATATCTTTCTATAGCCACTAGTAATCTACAATTGTCAAGAGCAAGCAGTATTTTTATGCTTCTAGCATATACTGGATACATCTTCTTTCAATTAAAAGCACATCGACAATTTTTTGATGCACAAGAGGGAGATGAAAATGAAGATGAAGAGAAGGCTGTGATAGGATTTAGGAGTGCATTTTCTTGGTTGGTCGAAATGACACTTATCATATCTCTGCTTTCTGAATATGTTGTTGCAACCATTGAGGCTGCTTCAGATTCTTGGGGCATTTCTGTTAGCTTCATTAGCATAATTTTGTTACCAATTGTGGGGAACGCTGCAGAACATGTTGGCTCAATCATATTTGCTTTTAAGAACAAGTTGGACATATCTTTGGGTGTTGCTATGGGATCTGCAACTCAAATTTCTATGTTTGTGGTTCCATTTAGTGTGGTTATTGCATGGATAATGGGGATAGAAATGGACTTGGATTTCAATCTTCTTGAAACTGGGTGTCTTGCTTTTACAATTATTGTTACAGCATTCACTTTGCAGGATGGAACTTCACACTACCTGAAAGGAGTGGTTCTTTTTCTGTGCTACATCATCATTGCTGCATGCTTTTTTGTTCACAAAACTAGTACTCCACTAATCAGCTTGGAGGTCCACAAAGAAAGTCAGCAAACCATAGAAGATAGATTTGAATGTTTCCATATCAATGATATAATAAGGCATATCCAGACTATAGTGTGGCATTTGGGAAACATCCTTGAAGTTTTCTCTTCACGATTTAATTCTGTTTACTAA

Predicted protein sequences of Glyma11g25250

Limit To All Plant Sequences

>Glyma11g25250.1   sequence type=predicted peptide   gene model=Glyma11g25250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
PWIFAWSLLGLTPLAERVSFFTDWRASECNLWKCNPDDHISVSTSPKQSKCCEVLSAGIHSLKPSITNLRKEQRYDKKEADVNSLLLLLGLLCHLLPLLLRYALAGEYLSIATSNLQLSRASSIFMLLAYTGYIFFQLKAHRQFFDAQEGDENEDEEKAVIGFRSAFSWLVEMTLIISLLSEYVVATIEAASDSWGISVSFISIILLPIVGNAAEHVGSIIFAFKNKLDISLGVAMGSATQISMFVVPFSVVIAWIMGIEMDLDFNLLETGCLAFTIIVTAFTLQDGTSHYLKGVVLFLCYIIIAACFFVHKTSTPLISLEVHKESQQTIEDRFECFHINDIIRHIQTIVWHLGNILEVFSSRFNSVY*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain