SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma11g21650

Feature Type:gene_model
Chromosome:Gm11
Start:18786219
stop:18788341
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g21650
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G57040AT Annotation by Michelle Graham. TAIR10: response regulator 9 | chr3:21110059-21111228 FORWARD LENGTH=234 SoyBaseE_val: 2.00E-73ISS
GO:0000160GO-bp Annotation by Michelle Graham. GO Biological Process: phosphorelay signal transduction system SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007623GO-bp Annotation by Michelle Graham. GO Biological Process: circadian rhythm SoyBaseN/AISS
GO:0009735GO-bp Annotation by Michelle Graham. GO Biological Process: response to cytokinin stimulus SoyBaseN/AISS
GO:0009736GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinin mediated signaling pathway SoyBaseN/AISS
GO:0009740GO-bp Annotation by Michelle Graham. GO Biological Process: gibberellic acid mediated signaling pathway SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0000156GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphorelay response regulator activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PTHR26402Panther RESPONSE REGULATOR OF TWO-COMPONENT SYSTEM JGI ISS
PTHR26402:SF52Panther JGI ISS
PF00072PFAM Response regulator receiver domain JGI ISS
UniRef100_I1LLD6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LLD6_SOYBN SoyBaseE_val: 4.00E-134ISS
UniRef100_Q1RU46UniRef Annotation by Michelle Graham. Most informative UniRef hit: Response regulator receiver n=1 Tax=Medicago truncatula RepID=Q1RU46_MEDTR SoyBaseE_val: 1.00E-87ISS

Proteins Associated with Glyma11g21650
LocusGene SymbolProtein Name
RR11 Root Preferential, Response Regulator Type-A

Expression Patterns of Glyma11g21650
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g21650 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g155100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g21650
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g21650
>Glyma11g21650.1   sequence type=CDS   gene model=Glyma11g21650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTATGGCTGCAGAAGCTCAGTTCCATGTTCTGGCTGTTGATGATAGCCTTATTGACAGAATGCTGATTGAGAGGCTCCTCAAAACCTCTTCCTTTCATGTTACTGCTGTGGATTCTGGTAGTAAGGCTTTGAAGTTTCTTGGTTTGGTTGAAGAGAAGAGAAATGAGGAGCCTCCTCCCTGTATTGCTCTAGAATCCCATCAGGATGTAGAAGTAAACCTGATCATAACTGATTACTGTATGCCAGAAATGACTGGCTATGATCTGCTGAGAAAGATCAAGGAATCTAAATCTCTTAAAGACATACCAGTGGTGATTATGTCCTCAGAGAATGTCCCAGCAAGGATTAACAGATGCCTAGAAGAGGGAGCTGATGAATTCTTTCTGAAACCAGTTCAACAGTCAGATGTAAACAAGCTGAGGCCACATTTGATGAAATCAAAAGTTAAGGATGGGGAAGACCAACAAATCAGTAACAAAAGGAAAGAAACAGAAGAAAGCCATTCCCCAGATAAAACTAGGACAAAAATGGAGCCTCAAAAAGTGGTTAATTTCAGTTAA
Predicted protein sequences of Glyma11g21650
>Glyma11g21650.1   sequence type=predicted peptide   gene model=Glyma11g21650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGMAAEAQFHVLAVDDSLIDRMLIERLLKTSSFHVTAVDSGSKALKFLGLVEEKRNEEPPPCIALESHQDVEVNLIITDYCMPEMTGYDLLRKIKESKSLKDIPVVIMSSENVPARINRCLEEGADEFFLKPVQQSDVNKLRPHLMKSKVKDGEDQQISNKRKETEESHSPDKTRTKMEPQKVVNFS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo