SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma11g20201

Feature Type:gene_model
Chromosome:Gm11
Start:17027026
stop:17027496
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g20201
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G08330AT Annotation by Michelle Graham. TAIR10: TCP family transcription factor | chr5:2680828-2681547 FORWARD LENGTH=239 SoyBaseE_val: 3.00E-29ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042752GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of circadian rhythm SoyBaseN/AISS
GO:0043433GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PTHR11584Panther SERINE/THREONINE PROTEIN KINASE JGI ISS
PTHR11584:SF275Panther SUBFAMILY NOT NAMED JGI ISS
PF03634PFAM TCP family transcription factor JGI ISS
UniRef100_G7IA90UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor TCP15 n=1 Tax=Medicago truncatula RepID=G7IA90_MEDTR SoyBaseE_val: 6.00E-30ISS
UniRef100_I1LL27UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LL27_SOYBN SoyBaseE_val: 4.00E-62ISS

Expression Patterns of Glyma11g20201
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g20201 not represented in the dataset
Glyma11g20201 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g20201 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g196000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g20201
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g20201
>Glyma11g20201.1   sequence type=CDS   gene model=Glyma11g20201   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCTGAGACACCTATCACTCTTAAAGCCATCAACACAAAGCTACCATCTTTGAAAGCAAAGAAGGATCGCCACACCAAGGTGAATGGGAGAGAACGCCGTGTTCTTTTGCCACCTTTATGTGCTGCTCGCGTCTTCCAACTCACTCATGAGTTAGGTTACAAGACTCATGGGGAGACCATAGAATGGCTTCTACGCCAGGCAGAACCTTCCATTATCGCCGCCACTGGCACTGGGATATTACCTTCTTCCATGGTTGTATCTGCATCAACATCAACCCCATCATTGTGTGAGGATGAAAGCACTATTGGTATGCATACAAATCCAATGGTTGTGTCAACAGACAATGAGATCGAGTCAAAAAAGGAATTTCTACCATTGGATCTTGATTCGTTGGCAAACTTTGATGTGGAGTTTTCTGCTAATGAGGTGGCAATCCTGCAATCATTGATCACAAAGTTGGGTTGA
Predicted protein sequences of Glyma11g20201
>Glyma11g20201.1   sequence type=predicted peptide   gene model=Glyma11g20201   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASETPITLKAINTKLPSLKAKKDRHTKVNGRERRVLLPPLCAARVFQLTHELGYKTHGETIEWLLRQAEPSIIAATGTGILPSSMVVSASTSTPSLCEDESTIGMHTNPMVVSTDNEIESKKEFLPLDLDSLANFDVEFSANEVAILQSLITKLG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo