SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma11g19800

Feature Type:gene_model
Chromosome:Gm11
Start:16576856
stop:16582346
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g19800
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G44880AT Annotation by Michelle Graham. TAIR10: Pheophorbide a oxygenase family protein with Rieske [2Fe-2S] domain | chr3:16383858-16386204 FORWARD LENGTH=537 SoyBaseE_val: 0ISS
GO:0008219GO-bp Annotation by Michelle Graham. GO Biological Process: cell death SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009816GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium, incompatible interaction SoyBaseN/AISS
GO:0009908GO-bp Annotation by Michelle Graham. GO Biological Process: flower development SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010154GO-bp Annotation by Michelle Graham. GO Biological Process: fruit development SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0015996GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll catabolic process SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009706GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast inner membrane SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0010277GO-mf Annotation by Michelle Graham. GO Molecular Function: chlorophyllide a oxygenase [overall] activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0032441GO-mf Annotation by Michelle Graham. GO Molecular Function: pheophorbide a oxygenase activity SoyBaseN/AISS
GO:0051536GO-mf Annotation by Michelle Graham. GO Molecular Function: iron-sulfur cluster binding SoyBaseN/AISS
GO:0051537GO-mf Annotation by Michelle Graham. GO Molecular Function: 2 iron, 2 sulfur cluster binding SoyBaseN/AISS
PTHR21266Panther IRON-SULFUR DOMAIN CONTAINING PROTEIN JGI ISS
PTHR21266:SF3Panther PHEOPHORBIDE A OXYGENASE JGI ISS
PF00355PFAM Rieske [2Fe-2S] domain JGI ISS
PF08417PFAM Pheophorbide a oxygenase JGI ISS
UniRef100_I1LKY8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LKY8_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q0H950UniRef Annotation by Michelle Graham. Most informative UniRef hit: Lethal leaf spot 1-like protein n=1 Tax=Glycine max RepID=Q0H950_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma11g19800
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g19800
ParalogEvidenceComments
Glyma12g08740 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g19800 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g192300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g19800
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g19800
>Glyma11g19800.1   sequence type=CDS   gene model=Glyma11g19800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGCTCCCTCACTCCATCTCTGCCTTAGCCACCACACTCACACTCTCCTCCCCAATAACCAAACCCCATAAAGTTAACCCCTTTCCCTTTTCCTCGAACCGAAATTCACAATTTTTAACGAAACAAACGCGACCCAGAAGCAGAAGAAACCTCTCCCTAACCCCTGCACGCGTTGCGGCGCCACCCTCAACGGTTGAAGCCGATCGATTATACCCAGAGGCCGAAAATAACGAAACTGAGGAAGAGTTTAGCGACGAGAGCTCTTCCTCTAAATTCACTTGGAGGGATCACTGGTACCCTGTCTCGTTAATTGAAGATCTGAACCCTCTCTTGCCCACACCGTTTCAGCTTCTGGGTCGTGAAATCGTGCTCTGGTACGACAAGTCCATTTCCCAATGGGTTGCTTTTGATGACAAATGCCCCCATCGTCTTGCCCCTTTATCTGAAGGGAGGATAGATGAAGATGGGAAGTTGCAGTGTTCTTATCATGGGTGGTCTTTTGATGGGTGTGGATCTTGTGTTAAGATTCCTCAGGCTTCATCTGAAGGCCCCGAAGCACGTGCTATTGGATCTCCTAAAGCATGTGCCACTAGGTTCCCTACCTTGGTGTCCCAGGGTTTGCTCTTTGTATGGCCTGATGAGAATGGTTGGGAGAAAGCAAAGGCCTCCAAGCCTCCAATGTTGCCTGATGACTTTGACAAACCGGAGTTTGCCACGGTCAACATTCAGCGTGATCTGTTCTATGGTTACGATACTCTCATGGAGAATGTCTCTGATCCTTCTCACATTGAGTTTGCTCATCACAAGGTCACGGGAAGGAGAGACAGAGCCAAACCTCTGCCATTCAAGATGGATTCTCGTGGTTCATGGGGCTTCTCTGGAGCTAATGAAGGGAACCCACAGATCAGTGCCAAGTTTGTTGCACCATGTTATATGATGAACAAGATTGAGATTGATACCAAACTCCCTGTAGTTGGTGACCAGAAATGGGTAGTATGGATATGTTCCTTCAATGTCCCCATGGCACCTGGTAAGACTCGCTCCATTGTTTGCAGTGCTCGAAACTTCTTCCAGTTCTCAGTGCCAGGGCCTGCCTGGTGGCAAGTCGTTCCTAGATGGTATGAGCATTGGACTTCAAATAAGGTATATGATGGAGACATGATTGTCCTTCAAGGTCAAGAGAAAATCTTCCTTTCAGAAACCAAGGAAGGTGGTGACATTAACAAACAGTACACAAACATCACCTTCACACCAACACAGGCAGATCGCTTTGTCTTGGCATTCCGAAATTGGCTGAGGCGACATGGCAATGGCCAACCAGAATGGTTTGGAAACAGCAGCGACCAGCCATTGCCATCAACTGTGTTATCAAAACGTCAGATGTTGGATAGATTTGAACAGCACACTCTCAAGTGTTCATCATGTAAAGCAGCATATGAGGGATTCCAAACATGGCAGAAAGTCCTAATTGGGGCAACAGTTGTGTTTTGTGCAACATCAGGGATCCCATCAGATTTCCAGTTGCGTGTACTTTTGGCTGGACTCGCAGTTGTCAGCGCAGCCATAGCTTTTGCCCTAAACCAACTCCAAAAGAATTTTGAATTCGTGGATTACGTGCATGCGGAAATCGATTAA
Predicted protein sequences of Glyma11g19800
>Glyma11g19800.1   sequence type=predicted peptide   gene model=Glyma11g19800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALPHSISALATTLTLSSPITKPHKVNPFPFSSNRNSQFLTKQTRPRSRRNLSLTPARVAAPPSTVEADRLYPEAENNETEEEFSDESSSSKFTWRDHWYPVSLIEDLNPLLPTPFQLLGREIVLWYDKSISQWVAFDDKCPHRLAPLSEGRIDEDGKLQCSYHGWSFDGCGSCVKIPQASSEGPEARAIGSPKACATRFPTLVSQGLLFVWPDENGWEKAKASKPPMLPDDFDKPEFATVNIQRDLFYGYDTLMENVSDPSHIEFAHHKVTGRRDRAKPLPFKMDSRGSWGFSGANEGNPQISAKFVAPCYMMNKIEIDTKLPVVGDQKWVVWICSFNVPMAPGKTRSIVCSARNFFQFSVPGPAWWQVVPRWYEHWTSNKVYDGDMIVLQGQEKIFLSETKEGGDINKQYTNITFTPTQADRFVLAFRNWLRRHGNGQPEWFGNSSDQPLPSTVLSKRQMLDRFEQHTLKCSSCKAAYEGFQTWQKVLIGATVVFCATSGIPSDFQLRVLLAGLAVVSAAIAFALNQLQKNFEFVDYVHAEID*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo