Glyma11g17460 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g17460): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g17460): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g17460

Feature Type:	gene_model
Chromosome:	Gm11
Start:	13473224
stop:	13477238
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g17460

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G12160	AT	Annotation by Michelle Graham. TAIR10: RAB GTPase homolog A4D \| chr3:3879495-3880437 REVERSE LENGTH=222	SoyBase	E_val: 1.00E-141	ISS
GO:0007264	GO-bp	Annotation by Michelle Graham. GO Biological Process: small GTPase mediated signal transduction	SoyBase	N/A	ISS
GO:0009827	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall modification	SoyBase	N/A	ISS
GO:0009860	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen tube growth	SoyBase	N/A	ISS
GO:0015031	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein transport	SoyBase	N/A	ISS
GO:0016192	GO-bp	Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport	SoyBase	N/A	ISS
GO:0048610	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular process involved in reproduction	SoyBase	N/A	ISS
GO:0048868	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen tube development	SoyBase	N/A	ISS
GO:0080092	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of pollen tube growth	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0045177	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apical part of cell	SoyBase	N/A	ISS
GO:0070382	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: exocytic vesicle	SoyBase	N/A	ISS
GO:0090404	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: pollen tube tip	SoyBase	N/A	ISS
GO:0005525	GO-mf	Annotation by Michelle Graham. GO Molecular Function: GTP binding	SoyBase	N/A	ISS
GO:0019900	GO-mf	Annotation by Michelle Graham. GO Molecular Function: kinase binding	SoyBase	N/A	ISS
KOG0087	KOG	GTPase Rab11/YPT3, small G protein superfamily	JGI		ISS
PTHR24073	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24073:SF213	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00071	PFAM	Ras family	JGI		ISS
UniRef100_D7MKD0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Small molecular weight G-protein 1 n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MKD0_ARALL	SoyBase	E_val: 4.00E-117	ISS
UniRef100_I1LKI4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LKI4_SOYBN	SoyBase	E_val: 4.00E-164	ISS

Expression Patterns of Glyma11g17460

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g17460 not represented in the dataset	Glyma11g17460 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g17460 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.U014000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma11g17460

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g17460

Limit To All Plant Sequences

>Glyma11g17460.1   sequence type=CDS   gene model=Glyma11g17460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGAATTTGTACGGGGATTATAACCAAAAGATTGATTACGTGTTCAAGGTGGTGTTGATTGGGGACTCCGCAGTTGGCAAAACTCAATTGCTTGCACGCTTTGCTAGGAACGAATTCAGTCTTGATTCCAAGGCAACCATTGGGGTTGAGTTTCAGACTAAAACTCTCATCATTGATAACAAGATCATCAAGGCTCAAATATGGGACACCGCTGGCCAAGAAAGGTACAGGGCAGTTACAAGTGCCTACTATAGAGGTGCTGTTGGGGCAATGTTAGTGTATGACATGACTAAGCGCCAATCGTTTGATCACATGGTAAAGTGGTTGGAAGAGTTGCGAGGCCATGCTGACCAAAACATTGTGATAATGCTAATTGGTAACAAGTGTGATTTGGGGAGCCTAAGAGCAGTGCCAATGGAAGATGCAGAGGAGCTTGCACAAAGAGAGAACCTTTTCTTTATGGAGACATCTGCACTTGAGTCCACAAATGTTGAAACTTGCTTTTTGACCATTTTAACTGAGATATATCGAATCCATGCCAAGAAATCACTCACTACCAGTGATGATGATATTGGGGGTTCGGGGCTTCTCAAGGGAAGCAGAATAATTGTTCCCAATCAAGAGATATATAATGGTGGAAAAAAGGGTGGTTGTTGTTTTGCCTCCTAG

Predicted protein sequences of Glyma11g17460

Limit To All Plant Sequences

>Glyma11g17460.1   sequence type=predicted peptide   gene model=Glyma11g17460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSNLYGDYNQKIDYVFKVVLIGDSAVGKTQLLARFARNEFSLDSKATIGVEFQTKTLIIDNKIIKAQIWDTAGQERYRAVTSAYYRGAVGAMLVYDMTKRQSFDHMVKWLEELRGHADQNIVIMLIGNKCDLGSLRAVPMEDAEELAQRENLFFMETSALESTNVETCFLTILTEIYRIHAKKSLTTSDDDIGGSGLLKGSRIIVPNQEIYNGGKKGGCCFAS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain