Glyma11g13911 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma11g13911

Feature Type:	gene_model
Chromosome:	Gm11
Start:	9935208
stop:	9938773
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g13911

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G20810	AT	Annotation by Michelle Graham. TAIR10: 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein \| chr3:7275814-7278144 FORWARD LENGTH=418	SoyBase	E_val: 0	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007623	GO-bp	Annotation by Michelle Graham. GO Biological Process: circadian rhythm	SoyBase	N/A	ISS
GO:0042752	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of circadian rhythm	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
KOG2132	KOG	Uncharacterized conserved protein, contains JmjC domain	JGI		ISS
PTHR12461	Panther	HYPOXIA-INDUCIBLE FACTOR 1 ALPHA INHIBITOR-RELATED	JGI		ISS
PTHR12461:SF3	Panther	UNCHARACTERIZED	JGI		ISS
PF08007	PFAM	Cupin superfamily protein	JGI		ISS
UniRef100_B9RI82	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor, putative n=1 Tax=Ricinus communis RepID=B9RI82_RICCO	SoyBase	E_val: 0	ISS
UniRef100_I1LQG9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LQG9_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma11g13911

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g13911 not represented in the dataset	Glyma11g13911 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g13911

Paralog	Evidence	Comments
Glyma12g05890	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g13911 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.11g130600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma11g13911

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g13911

Limit To All Plant Sequences

>Glyma11g13911.1   sequence type=CDS   gene model=Glyma11g13911   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGACGAACTCCGCATCCGGCGGTGACGCTCCTTCTCGCGGTTTTGATACGCCGACGCTGGACCTTGAATCGGCGGCGCTGCTCCACGCGATCTCCGAGCATGGCGGGTACGCGTACGTGAGCATGGCGGCTCTGGCGGCAAACGGCGACATTCGCGCGGCGGAGGCGGCGTGCGAGATGGCGTGGGAGCAGCTGCACTCGGGGCCGTGGCACTCGGTGCTGCCGGTGTGGCGCGACGCTTACTCCATGGCGTGCCTCCTCGTGGCGCGCCACCACTACCGCAACGGCGAGTTCAGGGACGCGCTTAGGGTTTTGGATTTGGGAATCATCATGGGAGGCACGCTCCTCCGCAAGGATTTGGACTCCGCCATCGAGAAAATTTCCGAACAAACGAGGAAGACCGTTAGGGTTTCTGATTTGGGGAACTCCGAGCACCGACTCGTCGATCGCGAATTTGATATGGCAGAGGTGCTCCAACTTTTACCTGTGAAGTCTCTTTCAAATAAGCTTGTGGCGAAGAAATCGGCACTGTCGCTGGAGAAATTCCTGAAGGATCATTACCTGTCTGGCTGCCCGGTTATTATCAGTGATTGTATGGCTCACTGGCCAGCCAAGATGAAATGGAATGACGAAGATTACTTACTGAGAGTTGCCGGTGACCGCACGGTTCCGGTTGAGGTTGGGAAAAACTATTTATGTACTGAGTGGAAGCAAGAGCTAATTACATTTTCAGAGTTTCTTCAGCGGATAAAGTCCGATAGCTGTTCTCCTGGTGGTCTTACATATCTTGCTCAGCATCCATTATTTGATCAGATAAATGAGCTTCGGAAAGATATCTTTATTCCTGACTATTGTTTTACTGGTGGAGGGGAGCTACGATCTCTCAATGCTTGGTTTGGTCCAGCAGGAACAGTGACACCGTTACACCATGATCCACATCATAACATACTAGCTCAGGTTGTTGGAAAGAAATACATTAGGCTTTACTCTTCATCTTTGTCTGAGGAACTTTCCCCCCACTCTGGTACCATGCTCCACAATTCCAGCCAGGTTGATTTAGATGACATAGATGAAAACAAGTTTCCGAAGGTGCAAGACTTGGAATTTGTAGACTGTATTTTAGAGGAAGGCGAAATGTTATATATCCCGCCAAAATGGTGGCACTATGTGCGCTCTTTGACTACCAGTTTTTCAGTTAGCTTTTGGTGGAGTGAGGGTGAAAGTTCGGATGCATCCTAA

Predicted protein sequences of Glyma11g13911

Limit To All Plant Sequences

>Glyma11g13911.1   sequence type=predicted peptide   gene model=Glyma11g13911   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLTNSASGGDAPSRGFDTPTLDLESAALLHAISEHGGYAYVSMAALAANGDIRAAEAACEMAWEQLHSGPWHSVLPVWRDAYSMACLLVARHHYRNGEFRDALRVLDLGIIMGGTLLRKDLDSAIEKISEQTRKTVRVSDLGNSEHRLVDREFDMAEVLQLLPVKSLSNKLVAKKSALSLEKFLKDHYLSGCPVIISDCMAHWPAKMKWNDEDYLLRVAGDRTVPVEVGKNYLCTEWKQELITFSEFLQRIKSDSCSPGGLTYLAQHPLFDQINELRKDIFIPDYCFTGGGELRSLNAWFGPAGTVTPLHHDPHHNILAQVVGKKYIRLYSSSLSEELSPHSGTMLHNSSQVDLDDIDENKFPKVQDLEFVDCILEEGEMLYIPPKWWHYVRSLTTSFSVSFWWSEGESSDAS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain