SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma11g13856

Feature Type:gene_model
Chromosome:Gm11
Start:9864728
stop:9867215
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g13856
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G25630AT Annotation by Michelle Graham. TAIR10: beta glucosidase 14 | chr2:10908360-10909880 FORWARD LENGTH=489 SoyBaseE_val: 3.00E-49ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0009860GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube growth SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0009505GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004553GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds SoyBaseN/AISS
GO:0043169GO-mf Annotation by Michelle Graham. GO Molecular Function: cation binding SoyBaseN/AISS
PTHR10353Panther GLYCOSIDE HYDROLASES JGI ISS
PF00232PFAM Glycosyl hydrolase family 1 JGI ISS
UniRef100_A8C6P5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Beta-glucosidase-like protein (Fragment) n=1 Tax=Trifolium repens RepID=A8C6P5_TRIRP SoyBaseE_val: 4.00E-59ISS
UniRef100_UPI000233C6FAUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233C6FA related cluster n=1 Tax=unknown RepID=UPI000233C6FA SoyBaseE_val: 1.00E-86ISS

Expression Patterns of Glyma11g13856
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g13856 not represented in the dataset
Glyma11g13856 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g13856 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g130000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g13856
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g13856
>Glyma11g13856.1   sequence type=CDS   gene model=Glyma11g13856   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGTGCTGCAAGTGAAGGTGGAAAAGGACCGAGTATATGGGATACTTTCACTCATAAATACCCAGAAAAAAATAAAAGAGGGAAGTAATGGAGAAGTAGCGGACGACTCATATCATCGGTATAAGGAGGATATTGGAATCATGAAGTATATGAATTTGGATGCTTATAGATTTTCCATTTCATGGTCTAAGATACTACCGAGAAAGCTTAGTGCAGGTGTAAACCATGAAGGAGTAAACTACTACAACAACCTCATCAATGAGCTCATGGCTAATGGTCTGCAACCATATGTGCAATCATATGTGACATTTTTCCATTGGGACGTCCCCCAAGCCTTAGAGGATGAAGATGATTTTAGGGACAGTGCTGAATTTTGCTTGAAGGAATTTGACAATAGGGTGAAACATTGGATTACTTTGAATGAACCGAGGAGTGCGAGCAAGAATGGCTATGCAAATGGCAGGCATCTCAAAAGGGTTTAA
Predicted protein sequences of Glyma11g13856
>Glyma11g13856.1   sequence type=predicted peptide   gene model=Glyma11g13856   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKVLQVKVEKDRVYGILSLINTQKKIKEGSNGEVADDSYHRYKEDIGIMKYMNLDAYRFSISWSKILPRKLSAGVNHEGVNYYNNLINELMANGLQPYVQSYVTFFHWDVPQALEDEDDFRDSAEFCLKEFDNRVKHWITLNEPRSASKNGYANGRHLKRV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo