SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g11870): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g11870): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g11870

Feature Type:gene_model
Chromosome:Gm11
Start:8472370
stop:8475446
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G38970AT Annotation by Michelle Graham. TAIR10: fructose-bisphosphate aldolase 2 | chr4:18163714-18165659 REVERSE LENGTH=398 SoyBaseE_val: 0ISS
GO:0000096GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006546GO-bp Annotation by Michelle Graham. GO Biological Process: glycine catabolic process SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006733GO-bp Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process SoyBaseN/AISS
GO:0006766GO-bp Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process SoyBaseN/AISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009072GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process SoyBaseN/AISS
GO:0009073GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process SoyBaseN/AISS
GO:0009106GO-bp Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process SoyBaseN/AISS
GO:0009108GO-bp Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process SoyBaseN/AISS
GO:0009117GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010304GO-bp Annotation by Michelle Graham. GO Biological Process: PSII associated light-harvesting complex II catabolic process SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019748GO-bp Annotation by Michelle Graham. GO Biological Process: secondary metabolic process SoyBaseN/AISS
GO:0019760GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate metabolic process SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0044272GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0010287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastoglobule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004332GO-mf Annotation by Michelle Graham. GO Molecular Function: fructose-bisphosphate aldolase activity SoyBaseN/AISS
KOG1557 KOG Fructose-biphosphate aldolase JGI ISS
PTHR11627Panther FRUCTOSE-BISPHOSPHATE ALDOLASE JGI ISS
PF00274PFAM Fructose-bisphosphate aldolase class-I JGI ISS
UniRef100_I1LJ68UniRef Annotation by Michelle Graham. Best UniRef hit: Fructose-bisphosphate aldolase n=1 Tax=Glycine max RepID=I1LJ68_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1LJ68UniRef Annotation by Michelle Graham. Most informative UniRef hit: Fructose-bisphosphate aldolase n=1 Tax=Glycine max RepID=I1LJ68_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g11870 not represented in the dataset

Glyma11g11870 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma12g04150 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g111100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma11g11870.1   sequence type=CDS   gene model=Glyma11g11870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTCTGCATCAGCATCTCTTCTCAAGTCTTCACTTGTTCTTGACAAGTCTGAGTGGGTGAAGGGACAAACACTTCGCCAACCTTCTGCTGCATCAGTTGTGAGATGCAACCCCACCACCCCATCAGGCCTCACAATCAGAGCTGGTTCCTATGCTGATGAGCTCGTTAAGACCGCGAAAACAGTGGCTTCACCAGGGAGGGGTATTTTGGCCATGGATGAGTCCAATGCTACCTGTGGGAAGCGTTTGGCTTCAATTGGGCTAGAGAACACTGAAGCTAACCGCCAGGCGTACCGTACCCTCCTTGTGACAGTTCCAGGACTTGGTCAGTACATCTCTGGTGCCATTCTCTTTGAGGAAACTCTCTACCAATCCACAACTGATGGCAGGAAGATTGTTGACGTGCTCCTCGAGCAAAACATTGTTCCCGGTATTAAAGTCGACAAGGGTTTGGTACCCCTTGCTGGTTCCAACGATGAGTCATGGTGCCAAGGTCTTGATGGTCTTGCCTCTCGCTCGGCTGCATACTACCAGCAAGGTGCCCGTTTCGCCAAATGGCGTACTGTTGTGAGCATCCCCAACGGTCCCTCTGCTCTGGCAGTTAAGGAAGCAGCCTGGGGTCTGGCTCGCTATGCCGCAATTGCTCAGGACAATGGATTGGTCCCAATTGTGGAGCCAGAGATCTTGCTTGATGGGGAGCATGGTATTGACAGAACTTTTGAAGTAGCAAAAAAGGTCTGGGCAGAGGTTTTCTTCTACCTTGCTGAGAACAATGTCCTTTTTGAGGGTATTCTTCTTAAGCCTAGCATGGTTACACCTGGAGCTGAGTCCAAGGACAAGGCCAGTCCTCAGACAGTTGCTGATTACACCCTCAAGCTCCTTCACAGGAGAATTCCCCCTGCTGTCCCTGGAATTATGTTTTTGTCTGGTGGACAGTCTGAGGTTGAAGCTACCCTCAACTTGAATGCCATGAACCAATCTCCAAACCCGTGGCACGTGTCGTTCTCGTATGCCAGAGCCCTCCAAAACACTGCCTTGAAGACATGGGGAGGCCGCCCAGAGAATGTGAAGGCGGCACAAGATGCACTTCTTTTCCGTGCCAAGTCCAACTCGCTCGCCCAGCTTGGGAAGTACACCGGTGAGGGTGAATCTGAGGAAGCCAAGAAGGAGTTGTTCGTCAAAGGCTACTCCTACTAA

>Glyma11g11870.1   sequence type=predicted peptide   gene model=Glyma11g11870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASASASLLKSSLVLDKSEWVKGQTLRQPSAASVVRCNPTTPSGLTIRAGSYADELVKTAKTVASPGRGILAMDESNATCGKRLASIGLENTEANRQAYRTLLVTVPGLGQYISGAILFEETLYQSTTDGRKIVDVLLEQNIVPGIKVDKGLVPLAGSNDESWCQGLDGLASRSAAYYQQGARFAKWRTVVSIPNGPSALAVKEAAWGLARYAAIAQDNGLVPIVEPEILLDGEHGIDRTFEVAKKVWAEVFFYLAENNVLFEGILLKPSMVTPGAESKDKASPQTVADYTLKLLHRRIPPAVPGIMFLSGGQSEVEATLNLNAMNQSPNPWHVSFSYARALQNTALKTWGGRPENVKAAQDALLFRAKSNSLAQLGKYTGEGESEEAKKELFVKGYSY*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo