SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g11520): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g11520): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g11520

Feature Type:gene_model
Chromosome:Gm11
Start:8219406
stop:8221090
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g11520
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G53300AT Annotation by Michelle Graham. TAIR10: ubiquitin-conjugating enzyme 10 | chr5:21632802-21633989 REVERSE LENGTH=148 SoyBaseE_val: 9.00E-102ISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0016881GO-mf Annotation by Michelle Graham. GO Molecular Function: acid-amino acid ligase activity SoyBaseN/AISS
GO:0031625GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin protein ligase binding SoyBaseN/AISS
KOG0417 KOG Ubiquitin-protein ligase JGI ISS
PTHR24068Panther FAMILY NOT NAMED JGI ISS
PF00179PFAM Ubiquitin-conjugating enzyme JGI ISS
UniRef100_G7JMD8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin carrier protein n=1 Tax=Medicago truncatula RepID=G7JMD8_MEDTR SoyBaseE_val: 7.00E-103ISS
UniRef100_UPI0001890C61UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001890C61 related cluster n=1 Tax=unknown RepID=UPI0001890C61 SoyBaseE_val: 1.00E-105ISS

Expression Patterns of Glyma11g11520
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g11520 not represented in the dataset
Glyma11g11520 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g11520
ParalogEvidenceComments
Glyma12g03670 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g11520 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g107800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g11520
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g11520
>Glyma11g11520.1   sequence type=CDS   gene model=Glyma11g11520   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATCCAAGAGAATACTGAAGGAGCTCAAGGACTTACAGAGAGATCCACCAACTTCATGCAGTGCAGGCCCTGTGGGCGAGGACATGTTCCATTGGCAAGCAACCATCATTGGTCCAAATGACAGTCCCTATGCTGGTGGTGTTTTCCTTGTGACCATCCATTTCCCTCCCGATTATCCCTTCAAACCTCCCAAGGTAGCATTCAGGACCAAGGTGTTCCATCCCAACATTAACAGCAATGGCAATATTTGCCTGGACATACTCAAAGAACAATGGAGTCCTGCTCTCACCATATCCAAGGTGCTGCTCTCTATATGTTCTCTGCTAACGGATCCAAATCCTGATGACCCTTTAGTGCCTGAAATTGCTCATTTGTGCAAGACCGACAAATTCAAGTATGAGTCTACTGCTAGAAGCTGGACCCAGAAGTATGCCATGGGCTAA
Predicted protein sequences of Glyma11g11520
>Glyma11g11520.1   sequence type=predicted peptide   gene model=Glyma11g11520   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASKRILKELKDLQRDPPTSCSAGPVGEDMFHWQATIIGPNDSPYAGGVFLVTIHFPPDYPFKPPKVAFRTKVFHPNINSNGNICLDILKEQWSPALTISKVLLSICSLLTDPNPDDPLVPEIAHLCKTDKFKYESTARSWTQKYAMG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo