Glyma11g11290 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g11290): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g11290): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g11290

Feature Type:	gene_model
Chromosome:	Gm11
Start:	8042351
stop:	8042956
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g11290

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G17870	AT	Annotation by Michelle Graham. TAIR10: cold shock domain protein 3 \| chr2:7764276-7765181 REVERSE LENGTH=301	SoyBase	E_val: 2.00E-31	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0009631	GO-bp	Annotation by Michelle Graham. GO Biological Process: cold acclimation	SoyBase	N/A	ISS
GO:0032508	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA duplex unwinding	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0003676	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
PTHR11544	Panther	COLD SHOCK DOMAIN CONTAINING PROTEINS	JGI		ISS
PTHR11544:SF12	Panther	Y BOX BINDING PROTEIN	JGI		ISS
PF00098	PFAM	Zinc knuckle	JGI		ISS
PF00313	PFAM	Cold-shock' DNA-binding domain	JGI		ISS
UniRef100_C1DZ42	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cold-shock DNA binding protein n=1 Tax=Micromonas sp. RCC299 RepID=C1DZ42_MICSR	SoyBase	E_val: 3.00E-35	ISS
UniRef100_I1LIZ5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LIZ5_SOYBN	SoyBase	E_val: 5.00E-63	ISS

Expression Patterns of Glyma11g11290

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g11290 not represented in the dataset	Glyma11g11290 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g11290

Paralog	Evidence	Comments
Glyma12g03470	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g11290 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma11g11290

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g11290

Limit To All Plant Sequences

>Glyma11g11290.5   sequence type=CDS   gene model=Glyma11g11290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTGGTAGGGTTTCTGGGAAGGTGAAGTGGTTCAACGATCAGAAGGGGTTTGGATTCATAACCCCTGACGATGGCAGCGAGGAACTCTTCGTTCACCAATCTCAGATCAAATCTGACGGTTTCCGAAGCCTAGCTGAAGGAGAGTCCGTTGAGTTCGCTATTGAATCTGAATCTGACGGACGCGCCAAGGCTGTTGATGTCACTGGCCCCGACGGCGCCAGCGTCCAGGGAACCAGACGCGGCGGTGATGGTGGCCGAAGCTATGGCGGGGGACGAGGAGGTGGTGGAGGAGGTGGTGGCGGCGGAGGAAGCTGCTACAGCTGTGGAGAGTCTGGGCATTTCGCCAGAGATTGCCCATCAAGTGCTCGTTGA

Predicted protein sequences of Glyma11g11290

Limit To All Plant Sequences

>Glyma11g11290.5   sequence type=predicted peptide   gene model=Glyma11g11290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSGRVSGKVKWFNDQKGFGFITPDDGSEELFVHQSQIKSDGFRSLAEGESVEFAIESESDGRAKAVDVTGPDGASVQGTRRGGDGGRSYGGGRGGGGGGGGGGGSCYSCGESGHFARDCPSSAR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain