SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g10310): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g10310): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g10310

Feature Type:gene_model
Chromosome:Gm11
Start:7411349
stop:7413326
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G47450AT Annotation by Michelle Graham. TAIR10: chloroplast signal recognition particle component (CAO) | chr2:19472781-19473902 FORWARD LENGTH=373 SoyBaseE_val: 7.00E-141ISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010155GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of proton transport SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0045038GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into chloroplast thylakoid membrane SoyBaseN/AISS
GO:0046777GO-bp Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0080085GO-cc Annotation by Michelle Graham. GO Cellular Compartment: signal recognition particle, chloroplast targeting SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0042802GO-mf Annotation by Michelle Graham. GO Molecular Function: identical protein binding SoyBaseN/AISS
PF00023PFAM Ankyrin repeat JGI ISS
PF00385PFAM chromo' (CHRromatin Organisation MOdifier) domain JGI ISS
UniRef100_B9RF69UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ankyrin repeat domain protein, putative n=1 Tax=Ricinus communis RepID=B9RF69_RICCO SoyBaseE_val: 2.00E-146ISS
UniRef100_UPI000233C6B1UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233C6B1 related cluster n=1 Tax=unknown RepID=UPI000233C6B1 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g10310 not represented in the dataset

Glyma11g10310 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g097200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma11g10310.1   sequence type=CDS   gene model=Glyma11g10310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGCCATATTCGCCACCAAACCCGCTTCCCATTCTCTCCTCTTAACTAAACTCTCTCCGAATCCCAAACACTTGTTCCCTCCACACCAACAATCCTTTCACAACATCCGCCACAAACCCACGCGCTTCCGCCCCGTCACCGCTGTTTTCCAAAACCAACATCAACAAGATGCAGCTGCAGCTTCCAACCACACCGAAGATGAGTCCTACGGCGAAGTCAAAGGCATCATTGGAAGCAGAGCCTTGGAAGCCGCCACCGGAATGGAGTACCTCATCGAGTGGAACGACGGCCACGCGCCGTCCTGGGTTCCCGCCGACTTCATAGCCAAAGACGTCGTCGACGAGTACGAAACTCCCTGGTGGACTGCCGCCAAGAAAGCCGACGAGTCCGCGTTGAAAAACTTAACCAAATCCGACGACGGCCGCGACGTCGACGCCGTGGACGCCGACGGCCGCACTGCGCTCCTCTTCGTCGCCGGACTCGGCTCGGAGTCCTGCGTGAAGCTGCTAGCGGAGGCCGGCGCGAATCTGGACCACCGCGACCGGAGCGGCGGCCTCGCGGCTCTGCACATGGCGGCGGGGTACGTCAGGCCCGGCGTGGCGAAGGTTCTCTTGGATCTCGGCGCGGATCCCGAGGTGGCGGACGACCGCGGGAGAACGGCGTTGGATCTGGCGAGGGAGATTCTGAAGGTGACGCCGAAGGGGAATCCGATGCAGTTCGGACGCAGGATTGGACTGGAAGGTGTGATTAGGGTTTTGGAAGGGGCAGTGTTCGAGTACGCGGAGGTGCAGGAGATTCTGGAACGGAGAGGAAAGGGTGAGAATTTGGAGTATCTTGTGCGGTGGAAGGACGGTGGTGCCAACGAGTGGGTGAAGGCGAAGTTTGTGGCGGAGGATTTGGTGAAAGACTACGAGGCTGGCCTCGAGTACGCCGTCGCTGAGGCGGTGCTCGCGAAAAGGGTAGCGGATGAAGGGACGCCGGAGTTTTTGGTTAAATGGGCCGATTTGGAGGAGCCCACATGGGAGCCCGAGGAGAATGTGGACCCAGAGCTTGTCAAAGCTTTCGAGGGAAGTAACAACCAGGCCCAGCCCAGTAGTAATGGGCCCGCTGTGGTCTTTTCCAATCAGGATAGCCCTAGCCTGTGA

>Glyma11g10310.1   sequence type=predicted peptide   gene model=Glyma11g10310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEAIFATKPASHSLLLTKLSPNPKHLFPPHQQSFHNIRHKPTRFRPVTAVFQNQHQQDAAAASNHTEDESYGEVKGIIGSRALEAATGMEYLIEWNDGHAPSWVPADFIAKDVVDEYETPWWTAAKKADESALKNLTKSDDGRDVDAVDADGRTALLFVAGLGSESCVKLLAEAGANLDHRDRSGGLAALHMAAGYVRPGVAKVLLDLGADPEVADDRGRTALDLAREILKVTPKGNPMQFGRRIGLEGVIRVLEGAVFEYAEVQEILERRGKGENLEYLVRWKDGGANEWVKAKFVAEDLVKDYEAGLEYAVAEAVLAKRVADEGTPEFLVKWADLEEPTWEPEENVDPELVKAFEGSNNQAQPSSNGPAVVFSNQDSPSL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo