SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g10190): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g10190): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g10190

Feature Type:gene_model
Chromosome:Gm11
Start:7306407
stop:7315468
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g10190
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G22200AT Annotation by Michelle Graham. TAIR10: Pyridoxal phosphate (PLP)-dependent transferases superfamily protein | chr3:7835286-7838863 FORWARD LENGTH=504 SoyBaseE_val: 0ISS
GO:0005985GO-bp Annotation by Michelle Graham. GO Biological Process: sucrose metabolic process SoyBaseN/AISS
GO:0006020GO-bp Annotation by Michelle Graham. GO Biological Process: inositol metabolic process SoyBaseN/AISS
GO:0006105GO-bp Annotation by Michelle Graham. GO Biological Process: succinate metabolic process SoyBaseN/AISS
GO:0006536GO-bp Annotation by Michelle Graham. GO Biological Process: glutamate metabolic process SoyBaseN/AISS
GO:0006540GO-bp Annotation by Michelle Graham. GO Biological Process: glutamate decarboxylation to succinate SoyBaseN/AISS
GO:0006541GO-bp Annotation by Michelle Graham. GO Biological Process: glutamine metabolic process SoyBaseN/AISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0009448GO-bp Annotation by Michelle Graham. GO Biological Process: gamma-aminobutyric acid metabolic process SoyBaseN/AISS
GO:0009450GO-bp Annotation by Michelle Graham. GO Biological Process: gamma-aminobutyric acid catabolic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009860GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube growth SoyBaseN/AISS
GO:0009865GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube adhesion SoyBaseN/AISS
GO:0010033GO-bp Annotation by Michelle Graham. GO Biological Process: response to organic substance SoyBaseN/AISS
GO:0010154GO-bp Annotation by Michelle Graham. GO Biological Process: fruit development SoyBaseN/AISS
GO:0010183GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube guidance SoyBaseN/AISS
GO:0019484GO-bp Annotation by Michelle Graham. GO Biological Process: beta-alanine catabolic process SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0003867GO-mf Annotation by Michelle Graham. GO Molecular Function: 4-aminobutyrate transaminase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0008483GO-mf Annotation by Michelle Graham. GO Molecular Function: transaminase activity SoyBaseN/AISS
GO:0030170GO-mf Annotation by Michelle Graham. GO Molecular Function: pyridoxal phosphate binding SoyBaseN/AISS
GO:0034387GO-mf Annotation by Michelle Graham. GO Molecular Function: 4-aminobutyrate:pyruvate transaminase activity SoyBaseN/AISS
GO:0050897GO-mf Annotation by Michelle Graham. GO Molecular Function: cobalt ion binding SoyBaseN/AISS
KOG1404 KOG Alanine-glyoxylate aminotransferase AGT2 JGI ISS
PTHR11986Panther AMINOTRANSFERASE CLASS III JGI ISS
PTHR11986:SF24Panther ADENOSYLMETHIONINE-8-AMINO-7-OXONONANOATE AMINOTRANSFERASE-RELATED JGI ISS
PF00202PFAM Aminotransferase class-III JGI ISS
UniRef100_G7JPM8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Aminotransferase y4uB n=1 Tax=Medicago truncatula RepID=G7JPM8_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1LIN0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LIN0_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma11g10190
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g10190 not represented in the dataset
Glyma11g10190 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g10190
ParalogEvidenceComments
Glyma12g02510 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g10190 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g096200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g10190
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g10190
>Glyma11g10190.1   sequence type=CDS   gene model=Glyma11g10190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCACACTCTCCTCCGATCCACTCTCAGGACCAAGACTGCTTCATCTTTAGCATATGCTGTGGTTTCCAGAAGTGCTCACGAAAATCTCCTTCAGGCTCCCTTATTGTCTAGATCAAATAGCACTGAGGCTTCATTGGCAAAGGATAATTCCTCTAATGATGTAAAAAATGGTCAAGGGTACAAAGGTCATAGTATGCTTGCTCCTTTCACGGCTGGGTGGCAGTCTTCTGATTTGCACCCTCTGATCATAGAAAAGTCAGAGGGAAGCTATGTATATGACATTAATGGGAAGAAATATCTTGATGCACTTGCTGGTCTATGGGCCACTTCTTTAGGGGGAAGTGAGCCACGCCTTGTTGATGCTGCCGTTGCACAACTAAAGAAGTTGCCATTTTACCATTCCTTTTGGAATCGAACCACATTACCTTCTTTGGATCTAGCAAAGGAACTCCTAGAAATGTTCACAGCCAGAAAAATGGGGAAAGCTTTTTTTGTTAATAGTGGATCAGAAGCCAATGACACTCAGGTGAAACTTGTATGGTATTATAACAATGCGCTTGGAAGACCAGATAAGAAGAAATTCATAGCTCGTGCTAAATCGTATCATGGTTCAACATTGATAGCAGCCAGTCTTTCTGGCCTTCCGGCTCTGCATCAAAAATTTGATTTGCCAGCTCCTTTTGTATTACACACTGACTGTCCACATTACTGGCGGTATCATCTTCCAGGTGAGACAGAGGAAGAATTTTCAACCAGATTAGCCAATAATTTGGAGCAGTTGATTCTGAAAGAGGGACCAGAGACTATTGCTGCATTTATTGCTGAACCTGTAATGGGGGCAGGAGGTGTAATACCTCCACCATCAACTTATTTTGAGAAGGTCCAAGCCGTTGTCAAGAAGTATGACATTCTTTTTATTGCAGATGAGGTAATATGTGCCTTTGGAAGGCTTGGGACAATGTTTGGATGTGACAAGTACAACATTAAGCCAGACCTTGTATCCCTGGCTAAGGCACTATCTTCTGCATATTTGCCAATTGGAGCTGTCCTTGTAAGCCCGGAAATATCAGAAGTTATACATGATCAAAGCAACAAACTAGGTTCATTTTCTCATGGTTTTACTTATTCTGGACACCCTGCAGCCTGTGCAGTTGCAATTGAAGCACTCAAGATCTATAAGGAAAGAAATATTGTTGACCAAGTGAACAAGATCGCCCCAAGGTTTCAAGATGGCATAAAAGCTTTTTCTGACAGTCCCATCATTGGAGAGATACGGGGAACTGGCTTGATTCTGGGCACTGAGTTCACAGACAACAAGTCACCTAATGATCCATTTCCTCCTGAATGGGGAATAGGTGCCTATTTTGGAGCACAATGTGAGAAGCATGGGATGTTAGTTCGTGTTGCGGGAGATAACATCATGATGTCTCCACCATATATTATATCTCCTGGAGAAGTTGAAGAGTTAATCAGCATTTATGGGAAAGCTTTGAAAGAAACGGAAAAGAAGGTACAGGAGCTCAAGTCTCAGCGCAAGTAG
Predicted protein sequences of Glyma11g10190
>Glyma11g10190.1   sequence type=predicted peptide   gene model=Glyma11g10190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHTLLRSTLRTKTASSLAYAVVSRSAHENLLQAPLLSRSNSTEASLAKDNSSNDVKNGQGYKGHSMLAPFTAGWQSSDLHPLIIEKSEGSYVYDINGKKYLDALAGLWATSLGGSEPRLVDAAVAQLKKLPFYHSFWNRTTLPSLDLAKELLEMFTARKMGKAFFVNSGSEANDTQVKLVWYYNNALGRPDKKKFIARAKSYHGSTLIAASLSGLPALHQKFDLPAPFVLHTDCPHYWRYHLPGETEEEFSTRLANNLEQLILKEGPETIAAFIAEPVMGAGGVIPPPSTYFEKVQAVVKKYDILFIADEVICAFGRLGTMFGCDKYNIKPDLVSLAKALSSAYLPIGAVLVSPEISEVIHDQSNKLGSFSHGFTYSGHPAACAVAIEALKIYKERNIVDQVNKIAPRFQDGIKAFSDSPIIGEIRGTGLILGTEFTDNKSPNDPFPPEWGIGAYFGAQCEKHGMLVRVAGDNIMMSPPYIISPGEVEELISIYGKALKETEKKVQELKSQRK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo