Glyma11g09111 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g09111): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g09111): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g09111

Feature Type:	gene_model
Chromosome:	Gm11
Start:	6442770
stop:	6443908
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g09111

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G66005	AT	Annotation by Michelle Graham. TAIR10: Expressed protein \| chr5:26397864-26398812 REVERSE LENGTH=147	SoyBase	E_val: 3.00E-34	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0016740	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity	SoyBase	N/A	ISS
GO:0017111	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity	SoyBase	N/A	ISS
GO:0019204	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide phosphatase activity	SoyBase	N/A	ISS
PTHR20953	Panther	KINASE-RELATED	JGI		ISS
PF03266	PFAM	Protein of unknown function, DUF265	JGI		ISS
UniRef100_G7K184	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Nucleoside-triphosphatase, putative n=1 Tax=Medicago truncatula RepID=G7K184_MEDTR	SoyBase	E_val: 8.00E-49	ISS
UniRef100_UPI000233D591	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233D591 related cluster n=1 Tax=unknown RepID=UPI000233D591	SoyBase	E_val: 2.00E-59	ISS

Expression Patterns of Glyma11g09111

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g09111 not represented in the dataset	Glyma11g09111 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g09111

Paralog	Evidence	Comments
Glyma01g36320	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g09111 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma11g09111

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g09111

Limit To All Plant Sequences

>Glyma11g09111.1   sequence type=CDS   gene model=Glyma11g09111   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGAGTGTTGGAGTCCCTCAAACTCAATGCCTCTCTCAAGCTTCCTCTTCCTTTCTCACATATAAAAAGCATTCATTACTGCAAAATGTCTCTCAGATGGCCTAACGTTGGCAAGTATAAAGTCGATGTTGCTTCCTTCGAGTCACTAGCACTGCTCGAGTTACAGGTTAGAGAAGACACCGATCTCTTCATCATTGACGAAGTTGGTAAGATGGAGTTATTCAGTTCCTCATTCTTCCCTGCAGTTCTAAGAGTTTTTGGAGTCAAATATCCCATAGCAAGGTTGCGGAATCATGCAGGGGCAACTTGTTTTACATTGAGCGTTAGTAACAGAGATGCTGTTAGAGAAAAGATACGCTCACAATTGGAAGATCTGCTGACAAAACACTAG

Predicted protein sequences of Glyma11g09111

Limit To All Plant Sequences

>Glyma11g09111.1   sequence type=predicted peptide   gene model=Glyma11g09111   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRVLESLKLNASLKLPLPFSHIKSIHYCKMSLRWPNVGKYKVDVASFESLALLELQVREDTDLFIIDEVGKMELFSSSFFPAVLRVFGVKYPIARLRNHAGATCFTLSVSNRDAVREKIRSQLEDLLTKH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain