SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g08750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g08750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g08750

Feature Type:gene_model
Chromosome:Gm11
Start:6189411
stop:6191395
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G35750AT Annotation by Michelle Graham. TAIR10: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein | chr4:16940865-16941674 REVERSE LENGTH=202 SoyBaseE_val: 2.00E-115ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG2633 KOG Hismacro and SEC14 domain-containing proteins JGI ISS
PTHR11106Panther GANGLIOSIDE INDUCED DIFFERENTIATION ASSOCIATED PROTEIN 2-RELATED JGI ISS
PTHR11106:SF1Panther gb def: cdna flj12480 fis, clone nt2rm1001066. 3/101 [dictyostelium discoideum] JGI ISS
UniRef100_C6TFU9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TFU9_SOYBN SoyBaseE_val: 3.00E-147ISS
UniRef100_G7JYT7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ganglioside-induced differentiation-associated protein n=2 Tax=Medicago truncatula RepID=G7JYT7_MEDTR SoyBaseE_val: 3.00E-118ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g08750 not represented in the dataset

Glyma11g08750 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma01g36600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g082500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma11g08750.1   sequence type=CDS   gene model=Glyma11g08750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGCTCTGCCATATCCCAAGTGGAACAAGAAGAGTTGCTCGAAAAATTAGAGGTGTTCAAGATCAAAGGCAGGGACAAGCATGGCCGCAAGATCCTTCGCATTATCGCCAAACTCTTCCCAGCGCGGTTGGTGAGTGTTGATGTTCTGAAGAAGTACCTGGAGGATAAGGTTTTCCCGAAGCTGGGGAAGAGGAAATTCGTGGTGCTGTACGTGCACACCGGCGTCCAGAGGAGCGAGAATTTTCCCGGAATCTCCGGTCTCCGGTGGATCTACGACTCGATTCCGGCGAACGTGAAGGAGAACCTCGAAGCCGTTTATTTTATTCACCCGGGCTTGCAGGCCCGCCTTTTCCTCGCTACCTTCGGCCGTTTCCTCTTCAACGCTGGGCTGTATGGAAAGCTGAGGTACGTGAGCAGGGTTGATTATCTGTGGGAGAATGTGAGGAGGAACGAAGTGGAGATTCCGGAGTTTGTGTTTGATCACGACGAGGATTTGGATTACCGTCCGATGATGGATTACGGATTGGAGAGCGATCACGCTAGAGTGTACGGTGGTGCTCCAACTATGGATTCACCCGTCACCACCTACTCCATGAGGTGCATCTCATAG

>Glyma11g08750.1   sequence type=predicted peptide   gene model=Glyma11g08750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MCSAISQVEQEELLEKLEVFKIKGRDKHGRKILRIIAKLFPARLVSVDVLKKYLEDKVFPKLGKRKFVVLYVHTGVQRSENFPGISGLRWIYDSIPANVKENLEAVYFIHPGLQARLFLATFGRFLFNAGLYGKLRYVSRVDYLWENVRRNEVEIPEFVFDHDEDLDYRPMMDYGLESDHARVYGGAPTMDSPVTTYSMRCIS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo