|
A newer version of this gene model can be found here:
Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
---|---|---|---|---|---|
AT2G23450 | AT | Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr2:9988926-9991244 REVERSE LENGTH=708 | SoyBase | E_val: 3.00E-65 | ISS |
GO:0006468 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein phosphorylation | SoyBase | N/A | ISS |
GO:0005575 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cellular component | SoyBase | N/A | ISS |
GO:0004672 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein kinase activity | SoyBase | N/A | ISS |
GO:0004674 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity | SoyBase | N/A | ISS |
GO:0005524 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATP binding | SoyBase | N/A | ISS |
GO:0016301 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: kinase activity | SoyBase | N/A | ISS |
GO:0016772 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups | SoyBase | N/A | ISS |
PTHR24420 | Panther | FAMILY NOT NAMED | JGI | ISS | |
PTHR24420:SF852 | Panther | JGI | ISS | ||
PF00069 | PFAM | Protein kinase domain | JGI | ISS | |
UniRef100_C7A7W3 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Kinase-like protein (Fragment) n=1 Tax=Corylus avellana RepID=C7A7W3_CORAV | SoyBase | E_val: 2.00E-71 | ISS |
UniRef100_I1J930 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J930_SOYBN | SoyBase | E_val: 5.00E-75 | ISS |
Glyma11g06451 not represented in the dataset |
Glyma11g06451 not represented in the dataset |
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Corresponding Name | Annotation Version | Evidence | Comments |
---|---|---|---|
Glyma.11g060700 | Wm82.a2.v1 | IGC | As supplied by JGI |
Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma11g06451.1 sequence type=CDS gene model=Glyma11g06451 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGAATGAGATCAAGCTACTTTCTTCAGTGAGTCGCCCGAATTTAGTTTGCCTCTTAGGTTACTGCATAGAGAAGGGAGAGCAGATCCTTGTTTATGAGTTTATGCAAAATGGAACACTTTCTCAGCATTTGCGAAGACAGAGGAGTAAAGGACTACCATGGACAATAAGACTCGCCATTGCTACTGAAACCGCTAATGCTATAGCATATCTCCATTCTGCAATTCATCCCCCAATTTACCACAGAGACATAAAATCTAGTAATATACTCTTGGATTATGGCTTCAAATATAAAATAGCTGATTTTGGGCTTTCTAGGCTTGCATTGACAGAAACATCTCATATCTCAACCGCCCCACAAGGGACTCCAGGTTATGTCGATCCCAATACCACCAGAACTTCCATCTTTCTGATAAAAGTGATGTCTACAGTTTTGGAGTGGTTTTAG
>Glyma11g06451.1 sequence type=predicted peptide gene model=Glyma11g06451 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MNEIKLLSSVSRPNLVCLLGYCIEKGEQILVYEFMQNGTLSQHLRRQRSKGLPWTIRLAIATETANAIAYLHSAIHPPIYHRDIKSSNILLDYGFKYKIADFGLSRLALTETSHISTAPQGTPGYVDPNTTRTSIFLIKVMSTVLEWF*
Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||