SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g06451): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g06451): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g06451

Feature Type:gene_model
Chromosome:Gm11
Start:4560175
stop:4562253
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g06451
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G23450AT Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr2:9988926-9991244 REVERSE LENGTH=708 SoyBaseE_val: 3.00E-65ISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0005575GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cellular component SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
PTHR24420Panther FAMILY NOT NAMED JGI ISS
PTHR24420:SF852Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_C7A7W3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Kinase-like protein (Fragment) n=1 Tax=Corylus avellana RepID=C7A7W3_CORAV SoyBaseE_val: 2.00E-71ISS
UniRef100_I1J930UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J930_SOYBN SoyBaseE_val: 5.00E-75ISS

Expression Patterns of Glyma11g06451
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g06451 not represented in the dataset
Glyma11g06451 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g06451 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g060700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g06451
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g06451
>Glyma11g06451.1   sequence type=CDS   gene model=Glyma11g06451   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATGAGATCAAGCTACTTTCTTCAGTGAGTCGCCCGAATTTAGTTTGCCTCTTAGGTTACTGCATAGAGAAGGGAGAGCAGATCCTTGTTTATGAGTTTATGCAAAATGGAACACTTTCTCAGCATTTGCGAAGACAGAGGAGTAAAGGACTACCATGGACAATAAGACTCGCCATTGCTACTGAAACCGCTAATGCTATAGCATATCTCCATTCTGCAATTCATCCCCCAATTTACCACAGAGACATAAAATCTAGTAATATACTCTTGGATTATGGCTTCAAATATAAAATAGCTGATTTTGGGCTTTCTAGGCTTGCATTGACAGAAACATCTCATATCTCAACCGCCCCACAAGGGACTCCAGGTTATGTCGATCCCAATACCACCAGAACTTCCATCTTTCTGATAAAAGTGATGTCTACAGTTTTGGAGTGGTTTTAG
Predicted protein sequences of Glyma11g06451
>Glyma11g06451.1   sequence type=predicted peptide   gene model=Glyma11g06451   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNEIKLLSSVSRPNLVCLLGYCIEKGEQILVYEFMQNGTLSQHLRRQRSKGLPWTIRLAIATETANAIAYLHSAIHPPIYHRDIKSSNILLDYGFKYKIADFGLSRLALTETSHISTAPQGTPGYVDPNTTRTSIFLIKVMSTVLEWF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo