SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g04160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g04160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g04160

Feature Type:gene_model
Chromosome:Gm11
Start:2765444
stop:2768798
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G47100AT Annotation by Michelle Graham. TAIR10: calcineurin B-like protein 9 | chr5:19129896-19131727 REVERSE LENGTH=213 SoyBaseE_val: 1.00E-108ISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0010107GO-bp Annotation by Michelle Graham. GO Biological Process: potassium ion import SoyBaseN/AISS
GO:0010118GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal movement SoyBaseN/AISS
GO:0019722GO-bp Annotation by Michelle Graham. GO Biological Process: calcium-mediated signaling SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0008287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: protein serine/threonine phosphatase complex SoyBaseN/AISS
GO:0005509GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium ion binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0034 KOG Ca2+/calmodulin-dependent protein phosphatase (calcineurin subunit B), EF-Hand superfamily protein JGI ISS
PTHR23056Panther CALCINEURIN B JGI ISS
PTHR23056:SF16Panther JGI ISS
UniRef100_I1LGV8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1LGV8_SOYBN SoyBaseE_val: 6.00E-131ISS
UniRef100_Q5EE13UniRef Annotation by Michelle Graham. Most informative UniRef hit: Calcineurin B-like protein n=1 Tax=Ammopiptanthus mongolicus RepID=Q5EE13_9FABA SoyBaseE_val: 7.00E-111ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g04160 not represented in the dataset

Glyma11g04160 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g038900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma11g04160.2   sequence type=CDS   gene model=Glyma11g04160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTTGTTTGCATTCCAAAGTAAGGGAATTTCCGGCAGAAGACCCATTTGCTCTAGCATCAGAGACAGCCTTCAGTGTTAATGATGTTGAAGCATTATATGAGCTTTTTAAGAGCATCAGTAGGTCCGTCGTTGATGATGGACTAATAAGTAAGGAAGAATTTCAATTGGCCATTTTCGATAATAAGAAAAAGGATAATCTTTTTACAAGTCGGATCTTTGATTTATTTGATGTTAAGAAAAAGGGAATGATTGACTTTGGTGACTTCGTTAGAGCGCTCAATGTCTTCCACCCATCTGTACCTATAGAAGTCAAGATAGATTTTTCATTTAGGCTCTACGACTTAGACAATACGGGATTTATAGAGCGTCAAGAGGTCGAGCAAATGCTAAATGCACTTCTTTGTGAAGCTGAAATTAAGTTGTCATATGAAATGATAGAAACAATTATTAACAAGACTTTCTTGGATGCCGACCTTAATCAAGATGGAAAAATAGACAAGTCTGAGTGGCTAAACTTTGTTTGTGAAAATCCTTCATTATTAAAAGTCATGACCCTGCCATACCTAAGGGACATAACAACTACTTTTCCAAGTTTTGTATTTCACTCAAAGGCGGAGGATGAAATTGCCGATTAA

>Glyma11g04160.2   sequence type=predicted peptide   gene model=Glyma11g04160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGCLHSKVREFPAEDPFALASETAFSVNDVEALYELFKSISRSVVDDGLISKEEFQLAIFDNKKKDNLFTSRIFDLFDVKKKGMIDFGDFVRALNVFHPSVPIEVKIDFSFRLYDLDNTGFIERQEVEQMLNALLCEAEIKLSYEMIETIINKTFLDADLNQDGKIDKSEWLNFVCENPSLLKVMTLPYLRDITTTFPSFVFHSKAEDEIAD*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo