Glyma11g04160 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g04160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g04160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g04160

Feature Type:	gene_model
Chromosome:	Gm11
Start:	2765444
stop:	2768798
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g04160

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G47100	AT	Annotation by Michelle Graham. TAIR10: calcineurin B-like protein 9 \| chr5:19129896-19131727 REVERSE LENGTH=213	SoyBase	E_val: 1.00E-108	ISS
GO:0006499	GO-bp	Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0010107	GO-bp	Annotation by Michelle Graham. GO Biological Process: potassium ion import	SoyBase	N/A	ISS
GO:0010118	GO-bp	Annotation by Michelle Graham. GO Biological Process: stomatal movement	SoyBase	N/A	ISS
GO:0019722	GO-bp	Annotation by Michelle Graham. GO Biological Process: calcium-mediated signaling	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0008287	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: protein serine/threonine phosphatase complex	SoyBase	N/A	ISS
GO:0005509	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium ion binding	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
KOG0034	KOG	Ca2+/calmodulin-dependent protein phosphatase (calcineurin subunit B), EF-Hand superfamily protein	JGI		ISS
PTHR23056	Panther	CALCINEURIN B	JGI		ISS
PTHR23056:SF16	Panther		JGI		ISS
UniRef100_I1LGV8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1LGV8_SOYBN	SoyBase	E_val: 6.00E-131	ISS
UniRef100_Q5EE13	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Calcineurin B-like protein n=1 Tax=Ammopiptanthus mongolicus RepID=Q5EE13_9FABA	SoyBase	E_val: 7.00E-111	ISS

Expression Patterns of Glyma11g04160

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g04160 not represented in the dataset	Glyma11g04160 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g04160 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.11g038900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma11g04160

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g04160

Limit To All Plant Sequences

>Glyma11g04160.2   sequence type=CDS   gene model=Glyma11g04160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTTGTTTGCATTCCAAAGTAAGGGAATTTCCGGCAGAAGACCCATTTGCTCTAGCATCAGAGACAGCCTTCAGTGTTAATGATGTTGAAGCATTATATGAGCTTTTTAAGAGCATCAGTAGGTCCGTCGTTGATGATGGACTAATAAGTAAGGAAGAATTTCAATTGGCCATTTTCGATAATAAGAAAAAGGATAATCTTTTTACAAGTCGGATCTTTGATTTATTTGATGTTAAGAAAAAGGGAATGATTGACTTTGGTGACTTCGTTAGAGCGCTCAATGTCTTCCACCCATCTGTACCTATAGAAGTCAAGATAGATTTTTCATTTAGGCTCTACGACTTAGACAATACGGGATTTATAGAGCGTCAAGAGGTCGAGCAAATGCTAAATGCACTTCTTTGTGAAGCTGAAATTAAGTTGTCATATGAAATGATAGAAACAATTATTAACAAGACTTTCTTGGATGCCGACCTTAATCAAGATGGAAAAATAGACAAGTCTGAGTGGCTAAACTTTGTTTGTGAAAATCCTTCATTATTAAAAGTCATGACCCTGCCATACCTAAGGGACATAACAACTACTTTTCCAAGTTTTGTATTTCACTCAAAGGCGGAGGATGAAATTGCCGATTAA

Predicted protein sequences of Glyma11g04160

Limit To All Plant Sequences

>Glyma11g04160.2   sequence type=predicted peptide   gene model=Glyma11g04160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGCLHSKVREFPAEDPFALASETAFSVNDVEALYELFKSISRSVVDDGLISKEEFQLAIFDNKKKDNLFTSRIFDLFDVKKKGMIDFGDFVRALNVFHPSVPIEVKIDFSFRLYDLDNTGFIERQEVEQMLNALLCEAEIKLSYEMIETIINKTFLDADLNQDGKIDKSEWLNFVCENPSLLKVMTLPYLRDITTTFPSFVFHSKAEDEIAD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain