SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma11g03880

Feature Type:gene_model
Chromosome:Gm11
Start:2598846
stop:2603539
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G47310AT Annotation by Michelle Graham. TAIR10: PPPDE putative thiol peptidase family protein | chr5:19201325-19202674 FORWARD LENGTH=245 SoyBaseE_val: 3.00E-104ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG0324 KOG Uncharacterized conserved protein JGI ISS
PTHR12378Panther UNCHARACTERIZED JGI ISS
PF05903PFAM PPPDE putative peptidase domain JGI ISS
UniRef100_C6TEF8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TEF8_SOYBN SoyBaseE_val: 3.00E-165ISS
UniRef100_G7JHP3UniRef Annotation by Michelle Graham. Most informative UniRef hit: EREBP-4 like protein n=1 Tax=Medicago truncatula RepID=G7JHP3_MEDTR SoyBaseE_val: 3.00E-101ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma01g41550 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g036200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma11g03880.1   sequence type=CDS   gene model=Glyma11g03880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCGGTGGTTTCCGTTGAGTACTACCTCAAACTCGGAAAGAGAACGGAATAGAGAGAACACTAGTCGTACTTCGGTGTATCTCAATGTATATGATCTTACTCCCATAAACAATTACCTTTACATGTTTGGCCTTGGAATTTTTCATTCGGGTATACAAGTGCATGACATTGAATATGGCTTTGGAGCACATGAATATCCAAGTAGTGGTGTGTTTGAGGTGGAACCTAGAAGCTGCCCTGGCTTCATCTTTCGACGATCAGTGTTGTTGGGCAGCACTGATATGTCTAACTCAGAATTTCGAGCTTTCATAGAGCACTTGTCTGCAAAATATCATGGAGACACTTATCATCTTATTGCCAAAAACTGCAACCATTTTACGGATGAAGTTTGCCAGCATCTAACAGGAAGTCCTATACCTGGATGGGTAAATCGGATGGCTCGTGTAGGTTCTTTCTGCAATTGTCTTCTGCCAGAAAGCCTCCAGGTTGCTGCAGTTAGACATCTCCCTGAACGTCTTGCATTTGATGATGATGATGGATCAGCATCTGATGGTCTTTCTGCATCCCTGGAGGGTGAAGAGGATGAGTCCAATCACCATTTACTAACTGGACCAAATGGTGATGTTGCCTTTCTAAAGGAGAAACCAGTTAGGCTGGCGCGGGAGCACCTATGA

>Glyma11g03880.1   sequence type=predicted peptide   gene model=Glyma11g03880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRWFPLSTTSNSERERNRENTSRTSVYLNVYDLTPINNYLYMFGLGIFHSGIQVHDIEYGFGAHEYPSSGVFEVEPRSCPGFIFRRSVLLGSTDMSNSEFRAFIEHLSAKYHGDTYHLIAKNCNHFTDEVCQHLTGSPIPGWVNRMARVGSFCNCLLPESLQVAAVRHLPERLAFDDDDGSASDGLSASLEGEEDESNHHLLTGPNGDVAFLKEKPVRLAREHL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo