Report for Sequence Feature Glyma11g03880
Feature Type: gene_model
Chromosome: Gm11
Start: 2598846
stop: 2603539
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma11g03880
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G47310 AT
Annotation by Michelle Graham. TAIR10: PPPDE putative thiol peptidase family protein | chr5:19201325-19202674 FORWARD LENGTH=245
SoyBase E_val: 3.00E-104 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005737 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
KOG0324
KOG
Uncharacterized conserved protein
JGI ISS
PTHR12378 Panther
UNCHARACTERIZED
JGI ISS
PF05903 PFAM
PPPDE putative peptidase domain
JGI ISS
UniRef100_C6TEF8 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TEF8_SOYBN
SoyBase E_val: 3.00E-165 ISS
UniRef100_G7JHP3 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: EREBP-4 like protein n=1 Tax=Medicago truncatula RepID=G7JHP3_MEDTR
SoyBase E_val: 3.00E-101 ISS
Expression Patterns of Glyma11g03880
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma11g03880
Paralog Evidence Comments
Glyma01g41550 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma11g03880 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.11g036200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma11g03880
Coding sequences of Glyma11g03880
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma11g03880.1 sequence type=CDS gene model=Glyma11g03880 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGCGGTGGTTTCCGTTGAGTACTACCTCAAACTCGGAAAGAGAACGGAATAGAGAGAACACTAGTCGTACTTCGGTGTATCTCAATGTATATGATCTTACTCCCATAAACAATTACCTTTACATGTTTGGCCTTGGAATTTTTCATTCGGGTATACAAGTGCATGACATTGAATATGGCTTTGGAGCACATGAATATCCAAGTAGTGGTGTGTTTGAGGTGGAACCTAGAAGCTGCCCTGGCTTCATCTTTCGACGATCAGTGTTGTTGGGCAGCACTGATATGTCTAACTCAGAATTTCGAGCTTTCATAGAGCACTTGTCTGCAAAATATCATGGAGACACTTATCATCTTATTGCCAAAAACTGCAACCATTTTACGGATGAAGTTTGCCAGCATCTAACAGGAAGTCCTATACCTGGATGGGTAAATCGGATGGCTCGTGTAGGTTCTTTCTGCAATTGTCTTCTGCCAGAAAGCCTCCAGGTTGCTGCAGTTAGACATCTCCCTGAACGTCTTGCATTTGATGATGATGATGGATCAGCATCTGATGGTCTTTCTGCATCCCTGGAGGGTGAAGAGGATGAGTCCAATCACCATTTACTAACTGGACCAAATGGTGATGTTGCCTTTCTAAAGGAGAAACCAGTTAGGCTGGCGCGGGAGCACCTATGA
Predicted protein sequences of Glyma11g03880
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma11g03880.1 sequence type=predicted peptide gene model=Glyma11g03880 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MRWFPLSTTSNSERERNRENTSRTSVYLNVYDLTPINNYLYMFGLGIFHSGIQVHDIEYGFGAHEYPSSGVFEVEPRSCPGFIFRRSVLLGSTDMSNSEFRAFIEHLSAKYHGDTYHLIAKNCNHFTDEVCQHLTGSPIPGWVNRMARVGSFCNCLLPESLQVAAVRHLPERLAFDDDDGSASDGLSASLEGEEDESNHHLLTGPNGDVAFLKEKPVRLAREHL*