Glyma11g03710 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g03710): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g03710): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g03710

Feature Type:	gene_model
Chromosome:	Gm11
Start:	2486726
stop:	2488981
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g03710

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G47435	AT	Annotation by Michelle Graham. TAIR10: formyltetrahydrofolate deformylase, putative \| chr5:19241779-19243424 FORWARD LENGTH=323	SoyBase	E_val: 2.00E-108	ISS
GO:0006189	GO-bp	Annotation by Michelle Graham. GO Biological Process: 'de novo' IMP biosynthetic process	SoyBase	N/A	ISS
GO:0009058	GO-bp	Annotation by Michelle Graham. GO Biological Process: biosynthetic process	SoyBase	N/A	ISS
GO:0009152	GO-bp	Annotation by Michelle Graham. GO Biological Process: purine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009853	GO-bp	Annotation by Michelle Graham. GO Biological Process: photorespiration	SoyBase	N/A	ISS
GO:0046653	GO-bp	Annotation by Michelle Graham. GO Biological Process: tetrahydrofolate metabolic process	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0008864	GO-mf	Annotation by Michelle Graham. GO Molecular Function: formyltetrahydrofolate deformylase activity	SoyBase	N/A	ISS
GO:0016742	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydroxymethyl-, formyl- and related transferase activity	SoyBase	N/A	ISS
KOG3076	KOG	5'-phosphoribosylglycinamide formyltransferase	JGI		ISS
PTHR10520	Panther	PHOSPHORIBOSYLAMINE-GLYCINE LIGASE	JGI		ISS
PTHR10520:SF7	Panther	FORMYLTETRAHYDROFOLATE DEFORMYLASE	JGI		ISS
PF00551	PFAM	Formyl transferase	JGI		ISS
UniRef100_G7KR22	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Formyltetrahydrofolate deformylase n=2 Tax=Medicago truncatula RepID=G7KR22_MEDTR	SoyBase	E_val: 2.00E-116	ISS
UniRef100_UPI000233D594	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233D594 related cluster n=1 Tax=unknown RepID=UPI000233D594	SoyBase	E_val: 3.00E-152	ISS

Expression Patterns of Glyma11g03710

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g03710 not represented in the dataset	Glyma11g03710 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g03710

Paralog	Evidence	Comments
Glyma01g41650	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g03710 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.11g034300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma11g03710

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g03710

Limit To All Plant Sequences

>Glyma11g03710.2   sequence type=CDS   gene model=Glyma11g03710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGATCTGTTATAAGGGTGCCAGCTCTGGATCCTAAATATAAGATTGCTGTTCTCGCAGCAAAGCAGGACCACTGTCTGATTGATTTGTTACATGGATGGCAGGATCGAAGACTCTCAGTAGATATTATCACTAGTGTAATTAGTAACCATTATCAAAGTCCAGAAAACGAGGTGATTCGTTTTCTTGAAATGCACGGTGTTCCTTATCATTACTTGAAAACAACAGCAGAGAATAAACGGGAAGAGGAGATCTTGGAGCTGGTTCAGAATACTGATTTTTTAGTACTTGCGAGGTATATGCGGATACTATCCAGCTTCTTTTTAAGGAGTTACGGGGAGGATATAATTAACATCCACCATGGCCTGTTACCATCATTTAGCAGTAGCAATCCATCTAAACAGGCCGTTGATGCGGGTGTGAAATTAATTGGCGCAACAAGTCACTTTGTAACTGAGAGACTTGCTGCTGGACCTATTATTGAACAAATGGTTGAAAGAGTTTCCCATAGAGATAAGTTGCAGAGCTTTGTGCAGAAATCAGAGAACCTTGAGAAACAATGCCTCACAAGCGTTATCAGATCTTATTGTGAGCTTCGAGTGTTGCCAATTGAAGAAAAGAACACTGTCGTATTCTGA

Predicted protein sequences of Glyma11g03710

Limit To All Plant Sequences

>Glyma11g03710.2   sequence type=predicted peptide   gene model=Glyma11g03710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRSVIRVPALDPKYKIAVLAAKQDHCLIDLLHGWQDRRLSVDIITSVISNHYQSPENEVIRFLEMHGVPYHYLKTTAENKREEEILELVQNTDFLVLARYMRILSSFFLRSYGEDIINIHHGLLPSFSSSNPSKQAVDAGVKLIGATSHFVTERLAAGPIIEQMVERVSHRDKLQSFVQKSENLEKQCLTSVIRSYCELRVLPIEEKNTVVF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain