Glyma11g03430 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g03430): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g03430): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g03430

Feature Type:	gene_model
Chromosome:	Gm11
Start:	2299051
stop:	2303442
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g03430

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G12110	AT	Annotation by Michelle Graham. TAIR10: nitrate transporter 1.1 \| chr1:4105341-4109290 FORWARD LENGTH=590	SoyBase	E_val: 0	ISS
GO:0006857	GO-bp	Annotation by Michelle Graham. GO Biological Process: oligopeptide transport	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0016126	GO-bp	Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process	SoyBase	N/A	ISS
GO:0019761	GO-bp	Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process	SoyBase	N/A	ISS
GO:0052541	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall cellulose metabolic process	SoyBase	N/A	ISS
GO:0052546	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall pectin metabolic process	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0015112	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nitrate transmembrane transporter activity	SoyBase	N/A	ISS
KOG1237	KOG	H+/oligopeptide symporter	JGI		ISS
PTHR11654	Panther	OLIGOPEPTIDE TRANSPORTER-RELATED	JGI		ISS
PTHR11654:SF37	Panther	OLIGOPEPTIDE TRANSPORTER-RELATED	JGI		ISS
PF00854	PFAM	POT family	JGI		ISS
UniRef100_G7JW11	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Nitrate transporter n=1 Tax=Medicago truncatula RepID=G7JW11_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI0001890C11	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0001890C11 related cluster n=1 Tax=unknown RepID=UPI0001890C11	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma11g03430

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g03430 not represented in the dataset	Glyma11g03430 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g03430

Paralog	Evidence	Comments
Glyma01g41930	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g03430 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.11g031500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma11g03430

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g03430

Limit To All Plant Sequences

>Glyma11g03430.1   sequence type=CDS   gene model=Glyma11g03430   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCAACCTCCCTACAACTCAAGGGAAAGCCATCCCTGATGCCTCCGACTACAAGGGCCGCCCCGCCGAGCGCTCTAAAACCGGTGGTTGGACCGCTTCCGCCATGATATTAGGAGGAGAAGTGATGGAGAGGTTGACAACACTAGGCATCGCGGTGAATTTGGTAACATATTTGACTGGGACCATGCATTTGGGTAATGCTGCCTCTGCCAACGTTGTAACCAACTTCTTGGGAACCTCCTTCATGCTCTGTCTGCTCGGTGGCTTCCTCGCCGATACTTTCCTCGGAAGATACCGCACCATCGCCATCTTCGCTGCCGTTCAAGCAACTGGTGTGACAATCTTGACAATATCAACCATAATTCCGAGCCTTCACCCTCCAAAGTGCAACGGAGACACCGTGCCACCTTGCGTGAGAGCAAATGAGAAACAATTAACGGTGCTTTATTTGGCGCTTTATGTAACGGCGCTCGGCACCGGAGGTTTGAAATCGAGTGTGTCCGGGTTCGGTTCGGATCAGTTCGATGATTCGGACGACGACGAGAAGAAGCAGATGATAAAGTTCTTCAACTGGTTCTACTTCTTCGTGAGCATAGGGTCTCTGGCCGCAACCACGGTTCTTGTGTACGTACAAGACAACATAGGACGAGGTTGGGGTTATGGTATCTGCGCGGGTGCGATCGTGGTGGCACTTCTCGTGTTCTTGTCGGGTACGAGGAAGTACCGTTTCAAGAAACTTGTGGGAAGTCCATTAACTCAGTTTGCGGAAGTGTTCGTGGCTGCTCTGAGAAAGAGGAACATGGAATTGCCCTCTGATTCATCATTGCTCTTTAATGACTACGACCCCAAGAAGCAGACTCTTCCTCATAGCAAGCAGTTCCGTTTCTTGGACAAAGCTGCAATCATGGATTCATCAGAATGCGGAGGTGGAATGAAGAGGAAATGGTATCTTTGCACCCTAACAGACGTGGAAGAAGTGAAAATGATTCTAAGAATGCTACCCATATGGGCCACCACCATCATGTTTTGGACAATCCACGCTCAAATGACCACATTCTCGGTGTCACAAGCGACAACCATGGACCGTCACATAGGAAAAACATTTCAAATGCCCGCGGCATCAATGACCGTTTTCTTAATTGGAACAATTCTCCTAACTGTCCCCTTCTACGACCGTTTCATTGTTCCCGTGGCAAAGAAAGTGCTCAAGAATCCACATGGTTTCACCCCTTTGCAACGCATTGGAGTCGGTTTAGTACTCTCAGTGGTTTCCATGGTGGTAGGAGCACTGATAGAAATAAAGAGACTAAGATATGCCCAATCACATGGTTTGGTAGATAAGCCAGAAGCAAAGATCCCTATGACCGTGTTTTGGTTGATACCACAGAACTTGTTTGTGGGGGCAGGGGAGGCATTTATGTACATGGGGCAGTTGGACTTTTTCCTTAGAGAGTGTCCCAAAGGGATGAAAACAATGAGCACGGGATTGTTCTTGAGCACACTCTCTTTGGGGTTTTTCTTTAGCACCTTGTTAGTGTCTATAGTGAACAAAATGACAGCACATGGTAGGCCATGGCTCGCAGATAATCTTAACCAAGGGAGGCTCTATGACTTTTACTGGCTCTTGGCTATATTGAGTGCTATAAATGTGGTCTTATACTTGGTTTGTGCTAAGTGGTACGTCTACAAGGAGAAGAGGCTTGCTGAAGAGTGCATTGAATTGGAAGAAGCAGATGCTGCTGCTTTCCATGGCCATTGA

Predicted protein sequences of Glyma11g03430

Limit To All Plant Sequences

>Glyma11g03430.1   sequence type=predicted peptide   gene model=Glyma11g03430   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSNLPTTQGKAIPDASDYKGRPAERSKTGGWTASAMILGGEVMERLTTLGIAVNLVTYLTGTMHLGNAASANVVTNFLGTSFMLCLLGGFLADTFLGRYRTIAIFAAVQATGVTILTISTIIPSLHPPKCNGDTVPPCVRANEKQLTVLYLALYVTALGTGGLKSSVSGFGSDQFDDSDDDEKKQMIKFFNWFYFFVSIGSLAATTVLVYVQDNIGRGWGYGICAGAIVVALLVFLSGTRKYRFKKLVGSPLTQFAEVFVAALRKRNMELPSDSSLLFNDYDPKKQTLPHSKQFRFLDKAAIMDSSECGGGMKRKWYLCTLTDVEEVKMILRMLPIWATTIMFWTIHAQMTTFSVSQATTMDRHIGKTFQMPAASMTVFLIGTILLTVPFYDRFIVPVAKKVLKNPHGFTPLQRIGVGLVLSVVSMVVGALIEIKRLRYAQSHGLVDKPEAKIPMTVFWLIPQNLFVGAGEAFMYMGQLDFFLRECPKGMKTMSTGLFLSTLSLGFFFSTLLVSIVNKMTAHGRPWLADNLNQGRLYDFYWLLAILSAINVVLYLVCAKWYVYKEKRLAEECIELEEADAAAFHGH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain