SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma11g02140

Feature Type:gene_model
Chromosome:Gm11
Start:1322676
stop:1324457
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g02140
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G23750AT Annotation by Michelle Graham. TAIR10: cytokinin response factor 2 | chr4:12376751-12377782 FORWARD LENGTH=343 SoyBaseE_val: 8.00E-51ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006606GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into nucleus SoyBaseN/AISS
GO:0042991GO-bp Annotation by Michelle Graham. GO Biological Process: transcription factor import into nucleus SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0042802GO-mf Annotation by Michelle Graham. GO Molecular Function: identical protein binding SoyBaseN/AISS
PF00847PFAM AP2 domain JGI ISS
UniRef100_G7KAN6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ethylene-responsive transcription factor RAP2-6 n=1 Tax=Medicago truncatula RepID=G7KAN6_MEDTR SoyBaseE_val: 2.00E-71ISS
UniRef100_I1LGA6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LGA6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma11g02140
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g02140
ParalogEvidenceComments
Glyma01g43350 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g02140 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g019000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g02140
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g02140
>Glyma11g02140.1   sequence type=CDS   gene model=Glyma11g02140   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACTGCGCCACCGACGAAGTACACTCACCACACCAAACTACTCATACCCCCCGAAGAAGACCCACCCAAACACCATTATCCCAGACTCGTCAGAATAACCGTCACTGACACCGACGCCACCGACTCCTCCAGCGACGAAGAAGAAGAACAAACATACCACTGCAACTCTTCCACGCGCCACCGACATAGGAAGTTCGTCAATGAGATTTCTATCGAGTCGTGCTCCAGCGAGAACGACGGCGTCGTTTCGAGGAAGCGAATTCGAAGAAGAAGCACCACTACGCCCAAAGCGACAAGAGCTTCAGACACTCGGCGCGTGTCCGACGGTAAGAAATTCCGCGGAGTGAGACAGAGGCCGTGGGGAAAATGGGCCGCGGAGATACGAGACCCAGCGCGACGCGTTCGGTTATGGTTGGGTACCTACGACACTGCTGAGGAAGCCGCTTTGGTGTACGACAACGCCGCCATTAAGCTGCGTGGACCCCACGCGCTCACCAATTTCATAACGCCACCTTCCGGGGAGGAAACTCATTGCAATAGCAAGAATATCTTTTCTCCCACTTCCGTGCTTCACTGTTGCTCCTTGTCCGAGGAAGCTGAGTCCGTTACGGCCAAAGACGATGACTACTCCTCGGTGTCGGAGAATAAGGTCAAAGCTGAGTCAGCGTTTCCGCCCGAAATAGATTTTGAGTTTCGAGCTTGTTCGACTGTGCCGGAGAGTCTGTTGTTCTGCGATGATGATTGGTCTAGTGAGTTTCTCAATTCTTATGAAGATTTCGGTTTCAAAAGTTGGCATACGGACAGAAATCGTGACTTTTTCCAAGATATCGACGATTTGTTTGTCTCGGATCCCCTCCTTGCTCTCTGA
Predicted protein sequences of Glyma11g02140
>Glyma11g02140.1   sequence type=predicted peptide   gene model=Glyma11g02140   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTAPPTKYTHHTKLLIPPEEDPPKHHYPRLVRITVTDTDATDSSSDEEEEQTYHCNSSTRHRHRKFVNEISIESCSSENDGVVSRKRIRRRSTTTPKATRASDTRRVSDGKKFRGVRQRPWGKWAAEIRDPARRVRLWLGTYDTAEEAALVYDNAAIKLRGPHALTNFITPPSGEETHCNSKNIFSPTSVLHCCSLSEEAESVTAKDDDYSSVSENKVKAESAFPPEIDFEFRACSTVPESLLFCDDDWSSEFLNSYEDFGFKSWHTDRNRDFFQDIDDLFVSDPLLAL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo