SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma11g01891): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma11g01891): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma11g01891

Feature Type:gene_model
Chromosome:Gm11
Start:1148843
stop:1149504
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma11g01891
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G10950AT Annotation by Michelle Graham. TAIR10: SGNH hydrolase-type esterase superfamily protein | chr4:6711502-6713512 REVERSE LENGTH=400 SoyBaseE_val: 3.00E-26ISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0016788GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, acting on ester bonds SoyBaseN/AISS
UniRef100_B9RCU4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Zinc finger protein, putative n=1 Tax=Ricinus communis RepID=B9RCU4_RICCO SoyBaseE_val: 3.00E-25ISS
UniRef100_I1LG69UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1LG69_SOYBN SoyBaseE_val: 7.00E-75ISS

Expression Patterns of Glyma11g01891
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma11g01891 not represented in the dataset
Glyma11g01891 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma11g01891 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g016500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma11g01891
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma11g01891
>Glyma11g01891.1   sequence type=CDS   gene model=Glyma11g01891   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGCCGAAGAAGATTTCTGGCCAAGATTGGAACGGGCTTCCTTTTGGCATTTGGATCAAGAGCCTTGCTTCAATTCCAAGATCCTCCTCCTCCCTCAACCGCACCTTTTTCTTCTCATGTTCCTTTAGCGCCGGCGCTGTTCGTCATCGGAGATTCCTCCGTTGATTGCGGAACCAACAATTTTCTGGGCACCTTCGCGCGCGCCCCGATCACCTTCCTTACGGAAAAGATTTCGACACCCACCAACCCGCCGGAAGATTCTCCAACGGAAGGATCCCCGTCGATTATCTTGCGTCTTGGGCTTCCTTTTGTGCCAAGTTATCTTGTGCAGACAGGGGTTGTGGAGGATATGATTAAAGGGGTAAACTACGCTTCTGCTGGTGCTGGCATTATTCTCTCTAGTGGCTCTTAA
Predicted protein sequences of Glyma11g01891
>Glyma11g01891.1   sequence type=predicted peptide   gene model=Glyma11g01891   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRRRFLAKIGTGFLLAFGSRALLQFQDPPPPSTAPFSSHVPLAPALFVIGDSSVDCGTNNFLGTFARAPITFLTEKISTPTNPPEDSPTEGSPSIILRLGLPFVPSYLVQTGVVEDMIKGVNYASAGAGIILSSGS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo