|
A newer version of this gene model can be found here:
Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
---|---|---|---|---|---|
AT3G06895 | AT | Annotation by Michelle Graham. TAIR10: unknown protein; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:2178129-2178284 FORWARD LENGTH=51 | SoyBase | E_val: 5.00E-10 | ISS |
GO:0008150 | GO-bp | Annotation by Michelle Graham. GO Biological Process: biological process | SoyBase | N/A | ISS |
GO:0003674 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: molecular function | SoyBase | N/A | ISS |
UniRef100_I1LFA2 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1LFA2_SOYBN | SoyBase | E_val: 5.00E-17 | ISS |
UniRef100_Q9M909 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: F17A9.5 protein n=1 Tax=Arabidopsis thaliana RepID=Q9M909_ARATH | SoyBase | E_val: 2.00E-07 | ISS |
Glyma10g43340 not represented in the dataset |
Glyma10g43340 not represented in the dataset |
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Corresponding Name | Annotation Version | Evidence | Comments |
---|
Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma10g43340.1 sequence type=CDS gene model=Glyma10g43340 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATTGAACTAGACATTGTAGGGCTTAACCCCGTAGGGAGCCCTTCCAGAAATTCTCGAAGGCCAGGGGTGAACCCAGGCCTAAGAGGGGGTTTGGAAATAGTTTTCAACCAGCAATAG
>Glyma10g43340.1 sequence type=predicted peptide gene model=Glyma10g43340 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high IELDIVGLNPVGSPSRNSRRPGVNPGLRGGLEIVFNQQ*
Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||