Glyma10g42611 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g42611): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g42611): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g42611

Feature Type:	gene_model
Chromosome:	Gm10
Start:	49519941
stop:	49520574
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g42611

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G10080	AT	Annotation by Michelle Graham. TAIR10: RmlC-like cupins superfamily protein \| chr3:3107476-3108159 REVERSE LENGTH=227	SoyBase	E_val: 4.00E-60	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0030145	GO-mf	Annotation by Michelle Graham. GO Molecular Function: manganese ion binding	SoyBase	N/A	ISS
GO:0045735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity	SoyBase	N/A	ISS
PF00190	PFAM	Cupin	JGI		ISS
UniRef100_C7S8D2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Germin-like protein 18 n=1 Tax=Glycine max RepID=C7S8D2_SOYBN	SoyBase	E_val: 4.00E-98	ISS
UniRef100_UPI000233D3AC	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233D3AC related cluster n=1 Tax=unknown RepID=UPI000233D3AC	SoyBase	E_val: 2.00E-102	ISS

Expression Patterns of Glyma10g42611

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g42611 not represented in the dataset	Glyma10g42611 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g42611 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g279600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g42611

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g42611

Limit To All Plant Sequences

>Glyma10g42611.1   sequence type=CDS   gene model=Glyma10g42611   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATCAACAAAGTAGCAGTTCTATTAGTTGTTTTGCTTTTCATCATTGCTGCTTTGGCTTCTGATCCTGATCCAGTCATAGACTTTTGCATAGCCAAATCACCAGACAATAGCTTCAGTTGCAAGAACTCATCCACAGCAACAGTGGAAGATTTCACATATTCTGGCATAAAGTCTCCTGGGAACTTCAAGCAAACTGGTTTTTCTTCTATGGCAGTGAATTCGAATGTCTTTCCAGGTTTCAACACTCTTAGCGTGTCATTCGTAGCAACAGAGGTTGCTTTTGCGCTGGAAGGAAAAATTTATTCAGGATTTGTGGATACCAAGAACAAGGTTTTTGCCAAAGTGTTGGAGAAAGGAGAGGTCATGGTGTTCCCAAGAGGCCTAGTGCACTTTCAGATGAATGTTGGAGATGGGCCTGCTACCATTTTGGGCATTTTTGGTTCTGACATAAAGGAGGAGCTTTTGGAGAAGGCTTTTGGACTGAGTTCTAAGGAACTTTCCAAGTTGAAGAAGAGGTTTTCTCCTAGTTAA

Predicted protein sequences of Glyma10g42611

Limit To All Plant Sequences

>Glyma10g42611.1   sequence type=predicted peptide   gene model=Glyma10g42611   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MINKVAVLLVVLLFIIAALASDPDPVIDFCIAKSPDNSFSCKNSSTATVEDFTYSGIKSPGNFKQTGFSSMAVNSNVFPGFNTLSVSFVATEVAFALEGKIYSGFVDTKNKVFAKVLEKGEVMVFPRGLVHFQMNVGDGPATILGIFGSDIKEELLEKAFGLSSKELSKLKKRFSPS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain