SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g42020

Feature Type:gene_model
Chromosome:Gm10
Start:49045487
stop:49048178
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g42020
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G68480AT Annotation by Michelle Graham. TAIR10: C2H2 and C2HC zinc fingers superfamily protein | chr1:25684543-25685932 REVERSE LENGTH=253 SoyBaseE_val: 4.00E-47ISS
GO:0009908GO-bp Annotation by Michelle Graham. GO Biological Process: flower development SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010093GO-bp Annotation by Michelle Graham. GO Biological Process: specification of floral organ identity SoyBaseN/AISS
GO:0010158GO-bp Annotation by Michelle Graham. GO Biological Process: abaxial cell fate specification SoyBaseN/AISS
GO:0048440GO-bp Annotation by Michelle Graham. GO Biological Process: carpel development SoyBaseN/AISS
GO:0048443GO-bp Annotation by Michelle Graham. GO Biological Process: stamen development SoyBaseN/AISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0048507GO-bp Annotation by Michelle Graham. GO Biological Process: meristem development SoyBaseN/AISS
GO:0048653GO-bp Annotation by Michelle Graham. GO Biological Process: anther development SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
UniRef100_C6ES39UniRef Annotation by Michelle Graham. Most informative UniRef hit: Lyrate n=1 Tax=Solanum lycopersicum RepID=C6ES39_SOLLC SoyBaseE_val: 3.00E-54ISS
UniRef100_I1LEW3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1LEW3_SOYBN SoyBaseE_val: 1.00E-103ISS

Proteins Associated with Glyma10g42020
LocusGene SymbolProtein Name
JAG2 JAGGED gene 2

Expression Patterns of Glyma10g42020
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g42020
ParalogEvidenceComments
Glyma20g25000 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g42020 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g273800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g42020
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g42020
>Glyma10g42020.2   sequence type=CDS   gene model=Glyma10g42020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGACCAGAACGAAACCCATTAGATCTTAACAATTTGCCCGATGAGTACTCTAGGGATGGCAAACAAGTCCTCGAAGACCATACCTCTTCACCCGGTTGCAGGAAAAAGAAAAGCGGCGGGAAGGATGGAAAAGACGAGTGTGGGAAGGTCTACGAGTGTAGATTTTGTTCCCTCAAGTTCTGCAAGTCTCAGGCTCTTGGGGGACACATGAACCGCCACCGCCAAGAGAGGGAAACGGAGACGCTGAACCAGGCTCGTCAACTGGTATTTCGTAGCGATCATATCATTGCTCCACAAGGTGCCCCTCACTTAGGATGCTGCCAGCCAATAGGAACGGGGGGTTATCACCCATCAGGAGACCCAACAGTGCCTCTAAGATTCCCGAGATACTTCTCAGGTTCATCCTCAACTCACATGCCACCACCGCCGCCGCCGCCGCCGCCACCGCAACAATCACACCTATACGCATCACCTTCGAGGCCAGTGTCATTTGGGTCATCACACTTCCCCCACCAGCATGCTGTGAACGATTACTATGTGGGCCACGTGATGAGTGGTGGGAGCCACGGACACTATGTTGGAGGAGAGAGCACGAGTAGTTACACGTACATTGGTGCCCCGGTGGGGCAAGCTGGTGGATTCGCTGGTGGTGGTAAGGAGGGGTCAGCAGTGCAGGAGGAAGGGTTGAGTTGGGGAAGGAGCTATTCAGGAGGAGCACAGCATCGTTTGGATCCTCCCTCAGCGATCAATCGGTTTCATGATGGTTTCTAA
Predicted protein sequences of Glyma10g42020
>Glyma10g42020.2   sequence type=predicted peptide   gene model=Glyma10g42020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRPERNPLDLNNLPDEYSRDGKQVLEDHTSSPGCRKKKSGGKDGKDECGKVYECRFCSLKFCKSQALGGHMNRHRQERETETLNQARQLVFRSDHIIAPQGAPHLGCCQPIGTGGYHPSGDPTVPLRFPRYFSGSSSTHMPPPPPPPPPPQQSHLYASPSRPVSFGSSHFPHQHAVNDYYVGHVMSGGSHGHYVGGESTSSYTYIGAPVGQAGGFAGGGKEGSAVQEEGLSWGRSYSGGAQHRLDPPSAINRFHDGF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo