Glyma10g41410 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g41410): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g41410): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g41410

Feature Type:	gene_model
Chromosome:	Gm10
Start:	48473395
stop:	48477958
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g41410

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G01120	AT	Annotation by Michelle Graham. TAIR10: origin recognition complex subunit 4 \| chr2:85444-88027 FORWARD LENGTH=418	SoyBase	E_val: 0	ISS
GO:0006260	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA replication	SoyBase	N/A	ISS
GO:0006306	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA methylation	SoyBase	N/A	ISS
GO:0006346	GO-bp	Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing	SoyBase	N/A	ISS
GO:0006396	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA processing	SoyBase	N/A	ISS
GO:0007062	GO-bp	Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion	SoyBase	N/A	ISS
GO:0008283	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell proliferation	SoyBase	N/A	ISS
GO:0009560	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation	SoyBase	N/A	ISS
GO:0009909	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of flower development	SoyBase	N/A	ISS
GO:0016458	GO-bp	Annotation by Michelle Graham. GO Biological Process: gene silencing	SoyBase	N/A	ISS
GO:0022402	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell cycle process	SoyBase	N/A	ISS
GO:0031048	GO-bp	Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA	SoyBase	N/A	ISS
GO:0034968	GO-bp	Annotation by Michelle Graham. GO Biological Process: histone lysine methylation	SoyBase	N/A	ISS
GO:0045132	GO-bp	Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation	SoyBase	N/A	ISS
GO:0051567	GO-bp	Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation	SoyBase	N/A	ISS
GO:0000808	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: origin recognition complex	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
KOG2228	KOG	Origin recognition complex, subunit 4	JGI		ISS
PTHR12087	Panther	ORIGIN RECOGNITION COMPLEX SUBUNIT 4	JGI		ISS
PF00004	PFAM	ATPase family associated with various cellular activities (AAA)	JGI		ISS
UniRef100_I1LEQ5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LEQ5_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q6EWX1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Origin recognition complex 4 subunit n=1 Tax=Arabidopsis thaliana RepID=Q6EWX1_ARATH	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma10g41410

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g41410 not represented in the dataset	Glyma10g41410 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g41410

Paralog	Evidence	Comments
Glyma20g25850	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g41410 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g268100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g41410

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g41410

Limit To All Plant Sequences

>Glyma10g41410.1   sequence type=CDS   gene model=Glyma10g41410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGCAAGAGAATCACAAAATCAAAGCAGTGAGTTTGCTTCGAAGCAGAATCTGTGATCCCAAATTCATCTTCATCAGTGAATCTCCAGAAAGCAACTACAGCAAGCTGAAATTCATGATATCGAGTTCGGTAACGGAAGCATGCAACAATTCTATTCTTCTTCTCGGTCCCCGCGGCTCCGGCAAGAATGCGGTTTTGGAGCTTGTCATTCAAGATTTGCTGCAAGAGTATCCGGACTCGGTCTCAGTGATAAGGTTGAATGGGCTTTTACATAGTGATGACATCTCTGCGTTCAAGGAAATAGCTAGGCAGTTATGCATGGAGCATCAATTGCTATTCTCAAAAGCGGCATCATTTGATGACAACTCCCAATTTATGGTGGCCATCCTAAAGGAATGTGGATTAGCACATAAAACAGTAATTTTTGTTCTGGATGAGTTTCACCTGTTTGCTCAGGGTAAACAGAGATTACTCTATAGCTTGCTAGATGCAATGCAATCAATAACATCACAGGCTGTTGTACTTGGCATTAGTTGCCGTCTGGATGCAGATCAGCTGTTGGAGAAAAGGGTACGATCTCGTTTTTCACATAGAAAGCTGTTGTTCCTACCACCTTCAATAGAAGATTCACAAAAATTACTGATGCACATCCTGACATTACCAATTGATTCAAGCTTTCCACATGCTTATGCTGTTGAATTTAACAGAAAGGTCCAAAATATTATAGAAGATAGAAGGTTCAAAGAAACCCTCAATAAATATTTAAATGTTGACTCCTCTGTCAAACATTTGCTGAGGTTCCTATTCTGTGCAGTCTCTCATATGGATTTGCAGACTGGGTTCCTGTCTCGGGAGAACTTTGAAATTGCATTTACAAGTATCCAGAGGCAGCCCAAACTGGAATGTTTAAGAAATTGCTCCATTTTAGAACTCCAAATTTTGGTTTGCATGAAGAGATTGGAAGTTAAAGAGCAAAGTTTATGCAACTTCAATTCTGTGATGAAAGAGTATATAAGCACCCTGACTTCTGAACGTTATGCAAGACATGTCTGCTTAAGGGCATTTGAACACCTTATACATCGTGAATTGATATGTTTCACAGACAATAGAGGACAAAGTTTGTCTGTTGAATTCCGTCCTGTAAAGCTTTTAATTTCATCTGCTGAACTACATCAAGGACTAAGAGCAAATACTTCATGCCCTCCTAAGCTTCTAAAATTAATGGATCGTGAAGGCTAA

Predicted protein sequences of Glyma10g41410

Limit To All Plant Sequences

>Glyma10g41410.1   sequence type=predicted peptide   gene model=Glyma10g41410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEQENHKIKAVSLLRSRICDPKFIFISESPESNYSKLKFMISSSVTEACNNSILLLGPRGSGKNAVLELVIQDLLQEYPDSVSVIRLNGLLHSDDISAFKEIARQLCMEHQLLFSKAASFDDNSQFMVAILKECGLAHKTVIFVLDEFHLFAQGKQRLLYSLLDAMQSITSQAVVLGISCRLDADQLLEKRVRSRFSHRKLLFLPPSIEDSQKLLMHILTLPIDSSFPHAYAVEFNRKVQNIIEDRRFKETLNKYLNVDSSVKHLLRFLFCAVSHMDLQTGFLSRENFEIAFTSIQRQPKLECLRNCSILELQILVCMKRLEVKEQSLCNFNSVMKEYISTLTSERYARHVCLRAFEHLIHRELICFTDNRGQSLSVEFRPVKLLISSAELHQGLRANTSCPPKLLKLMDREG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain