SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT5G08680 | AT | Annotation by Michelle Graham. TAIR10: ATP synthase alpha/beta family protein | chr5:2821992-2824683 FORWARD LENGTH=559 | SoyBase | E_val: 0 | ISS |
| GO:0006200 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP catabolic process | SoyBase | N/A | ISS |
| GO:0006754 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP biosynthetic process | SoyBase | N/A | ISS |
| GO:0015986 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP synthesis coupled proton transport | SoyBase | N/A | ISS |
| GO:0015991 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport | SoyBase | N/A | ISS |
| GO:0046034 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP metabolic process | SoyBase | N/A | ISS |
| GO:0046686 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cadmium ion | SoyBase | N/A | ISS |
| GO:0000275 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) | SoyBase | N/A | ISS |
| GO:0005739 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion | SoyBase | N/A | ISS |
| GO:0005753 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial proton-transporting ATP synthase complex | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0016469 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex | SoyBase | N/A | ISS |
| GO:0033178 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex, catalytic domain | SoyBase | N/A | ISS |
| GO:0045261 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting ATP synthase complex, catalytic core F(1) | SoyBase | N/A | ISS |
| GO:0000166 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: nucleotide binding | SoyBase | N/A | ISS |
| GO:0005507 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: copper ion binding | SoyBase | N/A | ISS |
| GO:0005524 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATP binding | SoyBase | N/A | ISS |
| GO:0008553 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: hydrogen-exporting ATPase activity, phosphorylative mechanism | SoyBase | N/A | ISS |
| GO:0016887 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATPase activity | SoyBase | N/A | ISS |
| GO:0017111 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity | SoyBase | N/A | ISS |
| GO:0046933 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: hydrogen ion transporting ATP synthase activity, rotational mechanism | SoyBase | N/A | ISS |
| GO:0046961 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: proton-transporting ATPase activity, rotational mechanism | SoyBase | N/A | ISS |
| KOG1350 | KOG | F0F1-type ATP synthase, beta subunit | JGI | ISS | |
| PTHR15184 | Panther | ATP SYNTHASE | JGI | ISS | |
| PTHR15184:SF8 | Panther | gb def: invasion protein [shigella flexneri] | JGI | ISS | |
| PF00006 | PFAM | ATP synthase alpha/beta family, nucleotide-binding domain | JGI | ISS | |
| PF00306 | PFAM | ATP synthase alpha/beta chain, C terminal domain | JGI | ISS | |
| PF02874 | PFAM | ATP synthase alpha/beta family, beta-barrel domain | JGI | ISS | |
| PF11421 | PFAM | ATP synthase F1 beta subunit | JGI | ISS | |
| UniRef100_I1NFS4 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: ATP synthase subunit beta n=1 Tax=Glycine max RepID=I1NFS4_SOYBN | SoyBase | E_val: 0 | ISS |
| UniRef100_UPI00019AA94A | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI00019AA94A related cluster n=1 Tax=unknown RepID=UPI00019AA94A | SoyBase | E_val: 0 | ISS |
|
Glyma10g41330 not represented in the dataset |
Glyma10g41330 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma20g25920 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.10g267200 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma10g41330.1 sequence type=CDS gene model=Glyma10g41330 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGCTTCACGCAGGCTCGTATCTTCTCTGATTCGATCCTCCCTTCGTAGATCTCAATCGAAGCCCTCAATTTCCGCATCGACATCGAGGCTCACGTCATCCAACCGTGCCTCACCGCACGGATACTTGCTGAACCGCGTCGCCGAGTACGCCACCGCCGCGGCTGCTGCTACCACTCCTCCCTCTCCTCCTCCTCCGGGGAAGAAGGAGCTCGGCGGCGGCGGGAAGATCACCGATGAATTCACCGGGAAGGGCGCGATCGGGCAGGTCTGCCAGGTCATTGGTGCCGTCGTCGATGTCAGATTCGACGAGGGTTTGCCTCCGATCATGACCGCGCTGGAGGTTCTGGATCACTCGTCGAGGCTTGTGTTGGAGGTGGCGCAGCATTTGGGTGAAGGCGTTGTCCGAACCATTGCTATGGATGCCACCGAAGGTGTCGTTAGAGGCTGGCGCGTTCTCAACACTGGCTCCCCTATTACCGTTCCAGTTGGTAGGGCTACCCTTGGCCGTATCATAAATGTCATTGGAGAGCCTATTGATGCCAAGGGAGAAATCAATACTGAGCATTATTTGCCCATTCATAGAGAAGCTCCTGCTTTTGTTGAGCAAGAAACTGCACAGCAGATTCTTGTTACTGGAATCAAGGTTGTTGACCTGCTTGCACCATATCAAAGAGGAGGAAAGATTGGGTTGTTTGGTGGTGCTGGTGTAGGAAAAACTGTGCTTATTATGGAACTTATTAACAATGTTGCAAAAGCTCATGGTGGTTTCTCTGTGTTTGCTGGTGTTGGAGAACGAACCCGAGAGGGTAATGACTTGTACAGAGAAATGATTGAGAGTGGTGTCATTAAGCTTGATGATAAGCAGAGTGAAAGCAAGTGTGCTCTTGTGTATGGTCAAATGAATGAGCCCCCTGGTGCCCGTGCCCGTGTTGGTCTTACTGGGCTTACTGTGGCTGAACACTTCCGTGATGCTGAAGGGCAAGATGTGCTTCTTTTCGTAGACAACATTTTCCGTTTTACCCAAGCTAACTCAGAGGTGTCTGCTTTGCTTGGTCGTATCCCATCTGCTGTTGGTTACCAACCAACCTTGTCTACTGATCTTGGAGCTCTTCAAGAGCGTATTACAACAACCAAGAAGGGTTCAATTACCTCTGTCCAAGCTATCTATGTGCCTGCTGATGACTTGACAGATCCTGCTCCTGCTACCACTTTTGCTCACTTGGATGCCACAACAGTGTTGTCACGACAGATCTCCGAGCTTGGTATCTATCCTGCTGTTGATCCCTTGGATTCTACATCTCGTATGCTTTCCCCCCTTATTTTGGGTGCGGATCACTACGAAACTGCTCGTGGTGTACAGAAAGTGCTTCAGAACTACAAGAATCTTCAAGATATCATTGCTATTTTGGGAATGGATGAGCTCAGTGAAGATGATAAATTGACTGTTGCCCGTGCCCGTAAGATTCAGCGATTCTTAAGCCAGCCTTTCCATGTTGCTGAAGTCTTCACTGGTGCCCCAGGAAAATATGTTGAGTTGAAGGAGAACGTTGCCAGCTTCCAGGGTGTGTTGGATGGAAAATACGATGACCTTCCAGAGCAGTCGTTTTACATGGTTGGCGGTATTGAGGAGGTCATTGCAAAGGCCGAGAAAATTGCTAAGGAATCTGCAGCGTCTTAA
>Glyma10g41330.1 sequence type=predicted peptide gene model=Glyma10g41330 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MASRRLVSSLIRSSLRRSQSKPSISASTSRLTSSNRASPHGYLLNRVAEYATAAAAATTPPSPPPPGKKELGGGGKITDEFTGKGAIGQVCQVIGAVVDVRFDEGLPPIMTALEVLDHSSRLVLEVAQHLGEGVVRTIAMDATEGVVRGWRVLNTGSPITVPVGRATLGRIINVIGEPIDAKGEINTEHYLPIHREAPAFVEQETAQQILVTGIKVVDLLAPYQRGGKIGLFGGAGVGKTVLIMELINNVAKAHGGFSVFAGVGERTREGNDLYREMIESGVIKLDDKQSESKCALVYGQMNEPPGARARVGLTGLTVAEHFRDAEGQDVLLFVDNIFRFTQANSEVSALLGRIPSAVGYQPTLSTDLGALQERITTTKKGSITSVQAIYVPADDLTDPAPATTFAHLDATTVLSRQISELGIYPAVDPLDSTSRMLSPLILGADHYETARGVQKVLQNYKNLQDIIAILGMDELSEDDKLTVARARKIQRFLSQPFHVAEVFTGAPGKYVELKENVASFQGVLDGKYDDLPEQSFYMVGGIEEVIAKAEKIAKESAAS*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
