Warning : Undefined variable $sxsome in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $sstart in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $send in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g41330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1019
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g41330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1021
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1025
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1031
Report for Sequence Feature Glyma10g41330
Feature Type: gene_model
Chromosome: Gm10
Start: 48435441
stop: 48439708
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma10g41330
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G08680 AT
Annotation by Michelle Graham. TAIR10: ATP synthase alpha/beta family protein | chr5:2821992-2824683 FORWARD LENGTH=559
SoyBase E_val: 0 ISS
GO:0006200 GO-bp
Annotation by Michelle Graham. GO Biological Process: ATP catabolic process
SoyBase N/A ISS
GO:0006754 GO-bp
Annotation by Michelle Graham. GO Biological Process: ATP biosynthetic process
SoyBase N/A ISS
GO:0015986 GO-bp
Annotation by Michelle Graham. GO Biological Process: ATP synthesis coupled proton transport
SoyBase N/A ISS
GO:0015991 GO-bp
Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport
SoyBase N/A ISS
GO:0046034 GO-bp
Annotation by Michelle Graham. GO Biological Process: ATP metabolic process
SoyBase N/A ISS
GO:0046686 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to cadmium ion
SoyBase N/A ISS
GO:0000275 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial proton-transporting ATP synthase complex, catalytic core F(1)
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0005753 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial proton-transporting ATP synthase complex
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0016469 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex
SoyBase N/A ISS
GO:0033178 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex, catalytic domain
SoyBase N/A ISS
GO:0045261 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting ATP synthase complex, catalytic core F(1)
SoyBase N/A ISS
GO:0000166 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleotide binding
SoyBase N/A ISS
GO:0005507 GO-mf
Annotation by Michelle Graham. GO Molecular Function: copper ion binding
SoyBase N/A ISS
GO:0005524 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ATP binding
SoyBase N/A ISS
GO:0008553 GO-mf
Annotation by Michelle Graham. GO Molecular Function: hydrogen-exporting ATPase activity, phosphorylative mechanism
SoyBase N/A ISS
GO:0016887 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ATPase activity
SoyBase N/A ISS
GO:0017111 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity
SoyBase N/A ISS
GO:0046933 GO-mf
Annotation by Michelle Graham. GO Molecular Function: hydrogen ion transporting ATP synthase activity, rotational mechanism
SoyBase N/A ISS
GO:0046961 GO-mf
Annotation by Michelle Graham. GO Molecular Function: proton-transporting ATPase activity, rotational mechanism
SoyBase N/A ISS
KOG1350
KOG
F0F1-type ATP synthase, beta subunit
JGI ISS
PTHR15184 Panther
ATP SYNTHASE
JGI ISS
PTHR15184:SF8 Panther
gb def: invasion protein [shigella flexneri]
JGI ISS
PF00006 PFAM
ATP synthase alpha/beta family, nucleotide-binding domain
JGI ISS
PF00306 PFAM
ATP synthase alpha/beta chain, C terminal domain
JGI ISS
PF02874 PFAM
ATP synthase alpha/beta family, beta-barrel domain
JGI ISS
PF11421 PFAM
ATP synthase F1 beta subunit
JGI ISS
UniRef100_I1NFS4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: ATP synthase subunit beta n=1 Tax=Glycine max RepID=I1NFS4_SOYBN
SoyBase E_val: 0 ISS
UniRef100_UPI00019AA94A UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI00019AA94A related cluster n=1 Tax=unknown RepID=UPI00019AA94A
SoyBase E_val: 0 ISS
Expression Patterns of Glyma10g41330
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma10g41330
Paralog Evidence Comments
Glyma20g25920 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma10g41330 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.10g267200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma10g41330
Coding sequences of Glyma10g41330
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma10g41330.1 sequence type=CDS gene model=Glyma10g41330 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCTTCACGCAGGCTCGTATCTTCTCTGATTCGATCCTCCCTTCGTAGATCTCAATCGAAGCCCTCAATTTCCGCATCGACATCGAGGCTCACGTCATCCAACCGTGCCTCACCGCACGGATACTTGCTGAACCGCGTCGCCGAGTACGCCACCGCCGCGGCTGCTGCTACCACTCCTCCCTCTCCTCCTCCTCCGGGGAAGAAGGAGCTCGGCGGCGGCGGGAAGATCACCGATGAATTCACCGGGAAGGGCGCGATCGGGCAGGTCTGCCAGGTCATTGGTGCCGTCGTCGATGTCAGATTCGACGAGGGTTTGCCTCCGATCATGACCGCGCTGGAGGTTCTGGATCACTCGTCGAGGCTTGTGTTGGAGGTGGCGCAGCATTTGGGTGAAGGCGTTGTCCGAACCATTGCTATGGATGCCACCGAAGGTGTCGTTAGAGGCTGGCGCGTTCTCAACACTGGCTCCCCTATTACCGTTCCAGTTGGTAGGGCTACCCTTGGCCGTATCATAAATGTCATTGGAGAGCCTATTGATGCCAAGGGAGAAATCAATACTGAGCATTATTTGCCCATTCATAGAGAAGCTCCTGCTTTTGTTGAGCAAGAAACTGCACAGCAGATTCTTGTTACTGGAATCAAGGTTGTTGACCTGCTTGCACCATATCAAAGAGGAGGAAAGATTGGGTTGTTTGGTGGTGCTGGTGTAGGAAAAACTGTGCTTATTATGGAACTTATTAACAATGTTGCAAAAGCTCATGGTGGTTTCTCTGTGTTTGCTGGTGTTGGAGAACGAACCCGAGAGGGTAATGACTTGTACAGAGAAATGATTGAGAGTGGTGTCATTAAGCTTGATGATAAGCAGAGTGAAAGCAAGTGTGCTCTTGTGTATGGTCAAATGAATGAGCCCCCTGGTGCCCGTGCCCGTGTTGGTCTTACTGGGCTTACTGTGGCTGAACACTTCCGTGATGCTGAAGGGCAAGATGTGCTTCTTTTCGTAGACAACATTTTCCGTTTTACCCAAGCTAACTCAGAGGTGTCTGCTTTGCTTGGTCGTATCCCATCTGCTGTTGGTTACCAACCAACCTTGTCTACTGATCTTGGAGCTCTTCAAGAGCGTATTACAACAACCAAGAAGGGTTCAATTACCTCTGTCCAAGCTATCTATGTGCCTGCTGATGACTTGACAGATCCTGCTCCTGCTACCACTTTTGCTCACTTGGATGCCACAACAGTGTTGTCACGACAGATCTCCGAGCTTGGTATCTATCCTGCTGTTGATCCCTTGGATTCTACATCTCGTATGCTTTCCCCCCTTATTTTGGGTGCGGATCACTACGAAACTGCTCGTGGTGTACAGAAAGTGCTTCAGAACTACAAGAATCTTCAAGATATCATTGCTATTTTGGGAATGGATGAGCTCAGTGAAGATGATAAATTGACTGTTGCCCGTGCCCGTAAGATTCAGCGATTCTTAAGCCAGCCTTTCCATGTTGCTGAAGTCTTCACTGGTGCCCCAGGAAAATATGTTGAGTTGAAGGAGAACGTTGCCAGCTTCCAGGGTGTGTTGGATGGAAAATACGATGACCTTCCAGAGCAGTCGTTTTACATGGTTGGCGGTATTGAGGAGGTCATTGCAAAGGCCGAGAAAATTGCTAAGGAATCTGCAGCGTCTTAA
Predicted protein sequences of Glyma10g41330
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma10g41330.1 sequence type=predicted peptide gene model=Glyma10g41330 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MASRRLVSSLIRSSLRRSQSKPSISASTSRLTSSNRASPHGYLLNRVAEYATAAAAATTPPSPPPPGKKELGGGGKITDEFTGKGAIGQVCQVIGAVVDVRFDEGLPPIMTALEVLDHSSRLVLEVAQHLGEGVVRTIAMDATEGVVRGWRVLNTGSPITVPVGRATLGRIINVIGEPIDAKGEINTEHYLPIHREAPAFVEQETAQQILVTGIKVVDLLAPYQRGGKIGLFGGAGVGKTVLIMELINNVAKAHGGFSVFAGVGERTREGNDLYREMIESGVIKLDDKQSESKCALVYGQMNEPPGARARVGLTGLTVAEHFRDAEGQDVLLFVDNIFRFTQANSEVSALLGRIPSAVGYQPTLSTDLGALQERITTTKKGSITSVQAIYVPADDLTDPAPATTFAHLDATTVLSRQISELGIYPAVDPLDSTSRMLSPLILGADHYETARGVQKVLQNYKNLQDIIAILGMDELSEDDKLTVARARKIQRFLSQPFHVAEVFTGAPGKYVELKENVASFQGVLDGKYDDLPEQSFYMVGGIEEVIAKAEKIAKESAAS*